National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9379R-3 
 Symbol by  Full Name blistery 
 CG No CG9379  Old CG No CG9379 
 Synonyms 3R-B, CG9379, CT26639, BcDNA:RE65113, by 
 Accession No (Link to NCBI) NM_141644.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Park SH, Lee CW, Lee JH, Park JY, Roshandell M, Brennan CA, Choe KM.
Requirement for and polarized localization of integrin proteins during Drosophila wound closure.
Mol Biol Cell (2018) 29(18) 2137-2147 [ PubMed ID = 29995573 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCAACACGTCTAACGAGCCC 
 Primer Seq. 3'
aatctagaggtaccGTTCCATGGTCCGCCGATTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCAACACGT CTAACGAGCC CTTTGCTGGT GCGCAAAACG CTGGGCAATG CCGTTAGTCC 
0061 CACCAGTTCG ACCAATACCA ACACCATAGC CAATACATAC CACTACAGGT CGAGCAGCGC 
0121 AACGCCGACG CCGGTGAGAG ATAATTTCGA GCAGCTGCTG CGGGAGCGAC GCGNAAAAGG 
0181 TCTACAATGA ATATAGGAAT CTGGATAGGG AGTCGTCCGG GGAGCGGGCC AGAGTGGCAC 
0241 CCGCTNCGCC GCAGAGGCAA TACTACCCGA GCGATGGCTA TGGAATTGGG CTGAAGAACG 
0301 ATAGCAATGG AACCCTATAC CGCAAGAGCC CCTCGTCTAA TGGGAAATCA ACGAAATACA 
0361 ACTACGATTT TGAGTTCAAT CTGAATCTGG ATGATGTTAG GCCCGAACCT ACACCGTATA 
0421 CCACGAGGAA TATTCACTTC GAGGATCTGC GGCTGGATCA GGATGTGCCA GATGGCGTGG 
0481 TCAATCGGCG GACCATGGAA C 
 in silico PCR Fragment
0001 ACCAACACGT CTAACGAGCC CTTTGCTGGT GCGCAAAACG CTGGGCAATG CCGTTAGTCC 
0061 CACCAGTTCG ACCAATACCA ACACCATAGC CAATACATAC CACTACACGT CGAGCAGCGC 
0121 AACGCCGACG CCGGTGAGAG ATAATTTCGA GCAGCTGCTG CGGGAGCGAC GCG-AAAAGG 
0181 TCTACAATGA ATATAGGAAT CTGGATAGGG AGTCGTCCGG GGAGCGGGCC AGAGTGGCAC 
0241 CCGCTCCGCC GCAGAGGCAA TACTACCCGA GCGATGGCTA TGGAATTGGG CTGAAGAACG 
0301 ATAGCAATGG AACCCTATAC CGCAAGAGCC CCTCGTCTAA TGGGAAATCA ACGAAATACA 
0361 ACTACGATTT TGAGTTCAAT CTGAATCTGG ATGATGTTAG GCCCGAACCT ACACCGTATA 
0421 CCACGAGGAA TATTCACTTC GAGGATCTGC GGCTGGATCA GGATGTGCCA GATGGCGTGG 
0481 TCAATCGGCG GACCATGGAA C 
 Assemble Data

9379R-3.IR_full       1   ACCAACACGTCTAACGAGCCCTTTGCTGGTGCGCAAAACGCTGGGCAATGCCGTTAGTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9379R-3.in silico     1   ACCAACACGTCTAACGAGCCCTTTGCTGGTGCGCAAAACGCTGGGCAATGCCGTTAGTCC 60


9379R-3.IR_full       61  CACCAGTTCGACCAATACCAACACCATAGCCAATACATACCACTACAGGTCGAGCAGCGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
9379R-3.in silico     61  CACCAGTTCGACCAATACCAACACCATAGCCAATACATACCACTACACGTCGAGCAGCGC 120


9379R-3.IR_full       121 AACGCCGACGCCGGTGAGAGATAATTTCGAGCAGCTGCTGCGGGAGCGACGCGNAAAAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
9379R-3.in silico     121 AACGCCGACGCCGGTGAGAGATAATTTCGAGCAGCTGCTGCGGGAGCGACGCG-AAAAGG 180


9379R-3.IR_full       181 TCTACAATGAATATAGGAATCTGGATAGGGAGTCGTCCGGGGAGCGGGCCAGAGTGGCAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9379R-3.in silico     181 TCTACAATGAATATAGGAATCTGGATAGGGAGTCGTCCGGGGAGCGGGCCAGAGTGGCAC 240


9379R-3.IR_full       241 CCGCTNCGCCGCAGAGGCAATACTACCCGAGCGATGGCTATGGAATTGGGCTGAAGAACG 300
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
9379R-3.in silico     241 CCGCTCCGCCGCAGAGGCAATACTACCCGAGCGATGGCTATGGAATTGGGCTGAAGAACG 300


9379R-3.IR_full       301 ATAGCAATGGAACCCTATACCGCAAGAGCCCCTCGTCTAATGGGAAATCAACGAAATACA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9379R-3.in silico     301 ATAGCAATGGAACCCTATACCGCAAGAGCCCCTCGTCTAATGGGAAATCAACGAAATACA 360


9379R-3.IR_full       361 ACTACGATTTTGAGTTCAATCTGAATCTGGATGATGTTAGGCCCGAACCTACACCGTATA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9379R-3.in silico     361 ACTACGATTTTGAGTTCAATCTGAATCTGGATGATGTTAGGCCCGAACCTACACCGTATA 420


9379R-3.IR_full       421 CCACGAGGAATATTCACTTCGAGGATCTGCGGCTGGATCAGGATGTGCCAGATGGCGTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9379R-3.in silico     421 CCACGAGGAATATTCACTTCGAGGATCTGCGGCTGGATCAGGATGTGCCAGATGGCGTGG 480


9379R-3.IR_full       481 TCAATCGGCGGACCATGGAAC 501
                          |||||||||||||||||||||
9379R-3.in silico     481 TCAATCGGCGGACCATGGAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141644.2  CG9379-RA (by), mRNA 
0.2   NM_141833.2  CG6791-RB, transcript variant B (CG6791), mRNA 
0.2   NM_169403.1  CG6791-RA, transcript variant A (CG6791), mRNA 
0   12  NM_165334.1  CG2488-RA, transcript variant A (phr6-4), mRNA 
0   12  NM_057840.3  CG2488-RB, transcript variant B (phr6-4), mRNA 
0   NM_141680.1  CG16908-RA (CG16908), mRNA 
0   NM_135937.2  CG4930-RA (CG4930), mRNA 
0   NM_176293.1  CG33171-RC, transcript variant C (CG33171), mRNA 
0   NM_176294.2  CG33171-RE, transcript variant E (CG33171), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 
0   13  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   13  NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   13  NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   13  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_078677.2  CG6186-RA (Tsf1), mRNA 
0   NM_141353.1  CG15580-RA, transcript variant A (CG15580), mRNA 
0   NM_169124.1  CG15580-RB, transcript variant B (CG15580), mRNA 
0   NM_143352.1  CG12870-RA (CG12870), mRNA 
0   NM_168443.1  CG11799-RA, transcript variant A (Mnf), mRNA 
0   NM_140183.1  CG11799-RE, transcript variant E (Mnf), mRNA 
0   NM_168446.1  CG11799-RD, transcript variant D (Mnf), mRNA 
0   NM_168444.1  CG11799-RB, transcript variant B (Mnf), mRNA 
0   NM_168445.1  CG11799-RC, transcript variant C (Mnf), mRNA 
0   NM_136132.4  CG10084-RA, transcript variant A (swm), mRNA 
0   NM_165304.1  CG10084-RB, transcript variant B (swm), mRNA 
0   NM_132479.2  CG1597-RA (CG1597), mRNA 
0   NM_139619.1  CG1332-RA (CG1332), mRNA 
0   NM_136439.2  CG11127-RA (CG11127), mRNA 
0   NM_134582.2  CG32513-RA, transcript variant A (bves), mRNA 
0   NM_206800.1  CG32513-RB, transcript variant B (bves), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.