National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9310R-2 
 Symbol Hnf4  Full Name Hepatocyte nuclear factor 4 
 CG No CG9310  Old CG No CG9310 
 Synonyms HNF4alpha, dHNF4, HNF-4, HNF4, HNF-4(D), NR2A4, DmHNF4, Hnf-4h, dHNF-4, CG9310, Hnf4, Hepatocyte nuclear factor 4, Hepatocyte nuclear factor 4 homologue, hepatocyte nuclear factor 4 
 Accession No (Link to NCBI) NM_057539.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Sinenko SA, Hung T, Moroz T, Tran QM, Sidhu S, Cheney MD, Speck NA, Banerjee U.
Genetic manipulation of AML1-ETO-induced expansion of hematopoietic precursors in a Drosophila model.
Blood (2010) 116(22) 4612-20 [ PubMed ID = 20688956 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGCATCCGCAGGATCTGAGT 
 Primer Seq. 3'
aatctagaggtaccCTCCTCCTGAAGAATCCTTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGCATCCGC AGGATCTGAG TGTCACGGAT GACCAGCAGT TAATGAAGGT GAACAAGGTG 
0061 GAGAAGATGG AGCAGGAGTT GCACGACCCC GAATCGGAGA GCCACATAAT GCACGCGGAT 
0121 GCCCTGGCCT CTGCCTATCC GGCTGCCTCG CAGCCCCACA GTCCGATCGG CCTCGCCCTC 
0181 AGCCCCAATG GCGGTGGGCT GGGACTGAGC AACAGTAGCA ACCAGAGCAG CGAGAACTTT 
0241 GCGCTCTGCA ACGGAAACGG AAATGCGGGC AGCGCAGGNA GGCGGAAGTG CCAGCAGTGG 
0301 CAGCAACAAC AACAACAGCA TGTTCTCACC CAACAACAAC TTGAGCGGAA GCGGAAGTGG 
0361 GACTAACAGC CAGTCAGCAG CAATTGCNAG CAGCAACAAC AACAGCAATC ACCGACGGTC 
0421 TGCGCCATTT GTGGAGATCG GGCGACGGGC AAACATTATG GAGCCTCCAG CTGCGACGGC 
0481 TGCAAAGGAT TCTTCAGGAG GAG 
 in silico PCR Fragment
0001 AAGCATCCGC AGGATCTGAG TGTCACGGAT GACCAGCAGT TAATGAAGGT GAACAAGGTG 
0061 GAGAAGATGG AGCAGGAGTT GCACGACCCC GAATCGGAGA GCCACATAAT GCACGCGGAT 
0121 GCCCTGGCCT CTGCCTATCC GGCTGCCTCG CAGCCCCACA GTCCGATCGG CCTCGCCCTC 
0181 AGCCCCAATG GCGGTGGGCT GGGACTGAGC AACAGTAGCA ACCAGAGCAG CGAGAACTTT 
0241 GCGCTCTGCA ACGGAAACGG AAATGCGGGC AGCGCAGG-A GGCGGAAGTG CCAGCAGTGG 
0301 CAGCAACAAC AACAACAGCA TGTTCTCACC CAACAACAAC TTGAGCGGAA GCGGAAGTGG 
0361 GACTAACAG- CAGTCAGCAG CAATTGC-AG CAGCAACAAC AACAGCAATC ACCGACGGTC 
0421 TGCGCCATTT GTGGAGATCG GGCGACGGGC AAACATTATG GAGCCTCCAG CTGCGACGGC 
0481 TGCAAAGGAT TCTTCAGGAG GAG 
 Assemble Data

9310R-2.IR_full       1   AAGCATCCGCAGGATCTGAGTGTCACGGATGACCAGCAGTTAATGAAGGTGAACAAGGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9310R-2.in silico     1   AAGCATCCGCAGGATCTGAGTGTCACGGATGACCAGCAGTTAATGAAGGTGAACAAGGTG 60


9310R-2.IR_full       61  GAGAAGATGGAGCAGGAGTTGCACGACCCCGAATCGGAGAGCCACATAATGCACGCGGAT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9310R-2.in silico     61  GAGAAGATGGAGCAGGAGTTGCACGACCCCGAATCGGAGAGCCACATAATGCACGCGGAT 120


9310R-2.IR_full       121 GCCCTGGCCTCTGCCTATCCGGCTGCCTCGCAGCCCCACAGTCCGATCGGCCTCGCCCTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9310R-2.in silico     121 GCCCTGGCCTCTGCCTATCCGGCTGCCTCGCAGCCCCACAGTCCGATCGGCCTCGCCCTC 180


9310R-2.IR_full       181 AGCCCCAATGGCGGTGGGCTGGGACTGAGCAACAGTAGCAACCAGAGCAGCGAGAACTTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9310R-2.in silico     181 AGCCCCAATGGCGGTGGGCTGGGACTGAGCAACAGTAGCAACCAGAGCAGCGAGAACTTT 240


9310R-2.IR_full       241 GCGCTCTGCAACGGAAACGGAAATGCGGGCAGCGCAGGNAGGCGGAAGTGCCAGCAGTGG 300
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
9310R-2.in silico     241 GCGCTCTGCAACGGAAACGGAAATGCGGGCAGCGCAGG-AGGCGGAAGTGCCAGCAGTGG 300


9310R-2.IR_full       301 CAGCAACAACAACAACAGCATGTTCTCACCCAACAACAACTTGAGCGGAAGCGGAAGTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9310R-2.in silico     301 CAGCAACAACAACAACAGCATGTTCTCACCCAACAACAACTTGAGCGGAAGCGGAAGTGG 360


9310R-2.IR_full       361 GACTAACAGCCAGTCAGCAGCAATTGCNAGCAGCAACAACAACAGCAATCACCGACGGTC 420
                          ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||
9310R-2.in silico     361 GACTAACAG-CAGTCAGCAGCAATTGC-AGCAGCAACAACAACAGCAATCACCGACGGTC 420


9310R-2.IR_full       421 TGCGCCATTTGTGGAGATCGGGCGACGGGCAAACATTATGGAGCCTCCAGCTGCGACGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9310R-2.in silico     421 TGCGCCATTTGTGGAGATCGGGCGACGGGCAAACATTATGGAGCCTCCAGCTGCGACGGC 480


9310R-2.IR_full       481 TGCAAAGGATTCTTCAGGAGGAG 503
                          |||||||||||||||||||||||
9310R-2.in silico     481 TGCAAAGGATTCTTCAGGAGGAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  11  46  NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
81.53   393  11  32  NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
81.32   392  11  32  NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
2.48   12  80  267  732  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.65   61  318  1156  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.65   61  318  1156  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.65   61  318  1156  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.65   31  145  331  NM_078592.2  CG11172-RA (NFAT), mRNA 
1.45   54  172  468  NM_135077.2  CG14023-RA (CG14023), mRNA 
1.45   20  88  240  NM_142597.2  CG12254-RA (MED25), mRNA 
1.45   17  100  279  NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
1.45   17  49  154  NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
1.45   17  49  139  NM_169291.1  CG9381-RB, transcript variant B (mura), mRNA 
1.45   17  49  139  NM_141645.2  CG9381-RA, transcript variant A (mura), mRNA 
1.45   14  67  179  NM_001043134.1  CG7368-RB (CG7368), mRNA 
1.24   36  103  264  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
1.24   36  99  241  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
1.24   36  99  240  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
1.24   35  116  277  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
1.24   35  116  277  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
1.24   30  93  270  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
1.24   30  93  270  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
1.24   28  137  362  NM_079903.2  CG15319-RB (nej), mRNA 
1.24   27  124  348  NM_078797.2  CG13109-RA (tai), mRNA 
1.24   19  97  265  NM_167000.1  CG32778-RA (CG32778), mRNA 
1.24   17  58  229  NM_137212.2  CG30089-RA (CG30089), mRNA 
1.24   16  59  168  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
1.24   16  48  130  NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
1.24   16  43  104  NM_079871.2  CG1775-RA, transcript variant A (Med), mRNA 
1.24   16  38  90  NM_170559.1  CG1775-RB, transcript variant B (Med), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.