National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9310R-1 
 Symbol Hnf4  Full Name Hepatocyte nuclear factor 4 
 CG No CG9310  Old CG No CG9310 
 Synonyms HNF4alpha, dHNF4, HNF-4, HNF4, HNF-4(D), NR2A4, DmHNF4, Hnf-4h, dHNF-4, CG9310, Hnf4, Hepatocyte nuclear factor 4, Hepatocyte nuclear factor 4 homologue, hepatocyte nuclear factor 4 
 Accession No (Link to NCBI) NM_057539.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Sinenko SA, Hung T, Moroz T, Tran QM, Sidhu S, Cheney MD, Speck NA, Banerjee U.
Genetic manipulation of AML1-ETO-induced expansion of hematopoietic precursors in a Drosophila model.
Blood (2010) 116(22) 4612-20 [ PubMed ID = 20688956 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGCATCCGCAGGATCTGAGTGTCACGGATGACCAGCAGTTAATGAAGGTGAACAAGGTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGAAGATGGAGCAGGAGTTGCACGACCCCGAATCGGAGAGCCACATAATGCACGCGGAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCCCTGGCCTCTGCCTATCCGGCTGCCTCGCAGCCCCACAGTCCGATCGGCCTCGCCCTC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCCCCAATGGCGGTGGGCTGGGACTGAGCAACAGTAGCAACCAGAGCAGCGAGAACTTT 240

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     241 GCGCTCTGCAACGGAAACGGAAATGCGGGCAGCGCAGG-AGGCGGAAGTGCCAGCAGTGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGCAACAACAACAACAGCATGTTCTCACCCAACAACAACTTGAGCGGAAGCGGAAGTGG 360

                          ||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| silico     361 GACTAACAG-CAGTCAGCAGCAATTGC-AGCAGCAACAACAACAGCAATCACCGACGGTC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGCGCCATTTGTGGAGATCGGGCGACGGGCAAACATTATGGAGCCTCCAGCTGCGACGGC 480

9310R-1.IR_full       481 TGCAAAGGATTCTTCAGGAGGAG 503
                          ||||||||||||||||||||||| silico     481 TGCAAAGGATTCTTCAGGAGGAG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  11  46  NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
81.53   393  11  32  NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
81.32   392  11  32  NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
2.48   12  80  267  732  NM_168571.2  CG32133-RA (CG32133), mRNA 
1.65   61  318  1156  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
1.65   61  318  1156  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
1.65   61  318  1156  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.65   31  145  331  NM_078592.2  CG11172-RA (NFAT), mRNA 
1.45   54  172  468  NM_135077.2  CG14023-RA (CG14023), mRNA 
1.45   20  88  240  NM_142597.2  CG12254-RA (MED25), mRNA 
1.45   17  100  279  NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
1.45   17  49  154  NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
1.45   17  49  139  NM_169291.1  CG9381-RB, transcript variant B (mura), mRNA 
1.45   17  49  139  NM_141645.2  CG9381-RA, transcript variant A (mura), mRNA 
1.45   14  67  179  NM_001043134.1  CG7368-RB (CG7368), mRNA 
1.24   36  103  264  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
1.24   36  99  241  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
1.24   36  99  240  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
1.24   35  116  277  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
1.24   35  116  277  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
1.24   30  93  270  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
1.24   30  93  270  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
1.24   28  137  362  NM_079903.2  CG15319-RB (nej), mRNA 
1.24   27  124  348  NM_078797.2  CG13109-RA (tai), mRNA 
1.24   19  97  265  NM_167000.1  CG32778-RA (CG32778), mRNA 
1.24   17  58  229  NM_137212.2  CG30089-RA (CG30089), mRNA 
1.24   16  59  168  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
1.24   16  48  130  NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
1.24   16  43  104  NM_079871.2  CG1775-RA, transcript variant A (Med), mRNA 
1.24   16  38  90  NM_170559.1  CG1775-RB, transcript variant B (Med), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.