National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9299R-2 
 Symbol Cpr76Bd  Full Name Cuticular protein 76Bd 
 CG No CG9299  Old CG No CG9299 
 Synonyms CG9299, Cpr76Bd 
 Accession No (Link to NCBI) NM_140866.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Shibata T, Ariki S, Shinzawa N, Miyaji R, Suyama H, Sako M, Inomata N, Koshiba T, Kanuka H, Kawabata S.
Protein crosslinking by transglutaminase controls cuticle morphogenesis in Drosophila.
PLoS ONE (2010) 5(10) e13477 [ PubMed ID = 20976106 ] [ RRC reference ]

Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCACCTTGGCTCCACCAATC 
 Primer Seq. 3'
aatctagaggtaccATTCCCGGACTTGCCGAACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCCACCTTGG CTCCACCAAT CTTGCCCTGC GTACACgNAT CCACTGCTGG TTATGCCTAT 
0061 CCTCCACCGG CGGAggTAAA GTTCTCCATC TCGCCCGGAG TGACGAAgNA CAGCCAGAGC 
0121 CCGGCGANTA TCCACGTACT CGGAGAACGG ACAACTCCTG CACACCTCGG TGGGAAGTTC 
0181 CGGAGCCGCC TATCAGTCTA CGGCCGGAAT CGAGGGCTTG TCTCACGGTG GCATAACTCA 
0241 GATCAACAAA TACATAGCTC CCGTGCAGAA GAGCCTGTTC TCTCNCCTCA ACGGAGTACG 
0301 GAGGAGCGGG AATTACCTAT GCGGACAAGT CACCAGCGGC CAAGTACGCA ACCGTTGTGC 
0361 CGTCGGGCAT CGAAATCAAG AACCTGGTGT CGCCGGCGGT TACCAAGTTG GACAACTCCT 
0421 ACTTGCCACC ATCACCCGGA ATCACTAAAG TGGCGACATA CACCTCGCCC GGATATAGTT 
0481 ACAGTTCGGC AAGTCCGGGA AT 
 in silico PCR Fragment
0001 CCCACCTTGG CTCCACCAAT CTTGCCCTGC GTACACGCAT CCACTGCTGG TTATGCCTAT 
0061 CCTCCACCGG CGGAGGTAAA GTTCTCCATC TCGCCCGGAG TGACGAAGTA CAGCCAGAGC 
0121 CCGGCGA-TA TCCACGTACT CGGAGAACGG ACAACTCCTG CACACCTCGG TGGGAAGTTC 
0181 CGGAGCCGCC TATCAGTCTA CGGCCGGAAT CGAGGGCTTG TCTCACGGTG GCATAACTCA 
0241 GATCAACAAA TACATAGCTC CCGTGCAGAA GAGCCTGTTC TCTC-CCTCA GCGGAGTACG 
0301 GAGGAGCGGG AATTACCTAT GCGGACAAGT CACCAGCGGC CAAGTACGCA ACCGTTGTGC 
0361 CGTCGGGCAT CGAAATCAAG AACCTGGTGT CGCCGGCGGT TACCAAGTTG GACAACTCCT 
0421 ACTTGCCACC ATCACCCGGA ATCACTAAAG TGGCGACATA CACCTCGCCC GGATATAGTT 
0481 ACAGTTCGGC AAGTCCGGGA AT 
 Assemble Data

9299R-2.IR_full       1   CCCACCTTGGCTCCACCAATCTTGCCCTGCGTACACGNATCCACTGCTGGTTATGCCTAT 60
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
9299R-2.in silico     1   CCCACCTTGGCTCCACCAATCTTGCCCTGCGTACACGCATCCACTGCTGGTTATGCCTAT 60


9299R-2.IR_full       61  CCTCCACCGGCGGAGGTAAAGTTCTCCATCTCGCCCGGAGTGACGAAGNACAGCCAGAGC 120
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
9299R-2.in silico     61  CCTCCACCGGCGGAGGTAAAGTTCTCCATCTCGCCCGGAGTGACGAAGTACAGCCAGAGC 120


9299R-2.IR_full       121 CCGGCGANTATCCACGTACTCGGAGAACGGACAACTCCTGCACACCTCGGTGGGAAGTTC 180
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
9299R-2.in silico     121 CCGGCGA-TATCCACGTACTCGGAGAACGGACAACTCCTGCACACCTCGGTGGGAAGTTC 180


9299R-2.IR_full       181 CGGAGCCGCCTATCAGTCTACGGCCGGAATCGAGGGCTTGTCTCACGGTGGCATAACTCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9299R-2.in silico     181 CGGAGCCGCCTATCAGTCTACGGCCGGAATCGAGGGCTTGTCTCACGGTGGCATAACTCA 240


9299R-2.IR_full       241 GATCAACAAATACATAGCTCCCGTGCAGAAGAGCCTGTTCTCTCNCCTCAACGGAGTACG 300
                          |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
9299R-2.in silico     241 GATCAACAAATACATAGCTCCCGTGCAGAAGAGCCTGTTCTCTC-CCTCAGCGGAGTACG 300


9299R-2.IR_full       301 GAGGAGCGGGAATTACCTATGCGGACAAGTCACCAGCGGCCAAGTACGCAACCGTTGTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9299R-2.in silico     301 GAGGAGCGGGAATTACCTATGCGGACAAGTCACCAGCGGCCAAGTACGCAACCGTTGTGC 360


9299R-2.IR_full       361 CGTCGGGCATCGAAATCAAGAACCTGGTGTCGCCGGCGGTTACCAAGTTGGACAACTCCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9299R-2.in silico     361 CGTCGGGCATCGAAATCAAGAACCTGGTGTCGCCGGCGGTTACCAAGTTGGACAACTCCT 420


9299R-2.IR_full       421 ACTTGCCACCATCACCCGGAATCACTAAAGTGGCGACATACACCTCGCCCGGATATAGTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9299R-2.in silico     421 ACTTGCCACCATCACCCGGAATCACTAAAGTGGCGACATACACCTCGCCCGGATATAGTT 480


9299R-2.IR_full       481 ACAGTTCGGCAAGTCCGGGAAT 502
                          ||||||||||||||||||||||
9299R-2.in silico     481 ACAGTTCGGCAAGTCCGGGAAT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  23  NM_140866.1  CG9299-RA (CG9299), mRNA 
0   NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_140662.2  CG13025-RA (CG13025), mRNA 
0   NM_205912.1  CG11020-RB, transcript variant B (nompC), mRNA 
0   NM_001031927.1  CG18170-RA, transcript variant A (CG18170), mRNA 
0   NM_001031926.1  CG18170-RB, transcript variant B (CG18170), mRNA 
0   NM_001031929.1  CG33791-RB, transcript variant B (CG33791), mRNA 
0   NM_001031928.1  CG33791-RC, transcript variant C (CG33791), mRNA 
0   NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_139427.2  CG1927-RA (CG1927), mRNA 
0   NM_176486.1  CG5834-RA (Hsp70Bbb), mRNA 
0   NM_169469.1  CG31449-RA (Hsp70Ba), mRNA 
0   NM_080188.2  CG31359-RA (Hsp70Bb), mRNA 
0   NM_141952.1  CG6489-RA (Hsp70Bc), mRNA 
0   NM_165550.1  CG30493-RB (CG30493), mRNA 
0   13  NM_132384.2  CG2962-RA (CG2962), mRNA 
0   NM_079969.2  CG9244-RB (Acon), mRNA 
0   NR_002459.1  CG9244-RB (Acon), mRNA, snoRNA 
0   NM_169526.1  CG31337-RA (CG31337), mRNA 
0   NM_135207.2  CG11319-RA (CG11319), mRNA 
0   NM_135024.1  CG11926-RA (CG11926), mRNA 
0   NM_079109.2  CG5575-RA (ken), mRNA 
0   NM_143227.1  CG5468-RA (CG5468), mRNA 
0   NM_164854.1  CG3747-RC, transcript variant C (Eaat1), mRNA 
0   NM_079427.2  CG6850-RA (Ugt), mRNA 
0   NM_079637.4  CG4843-RA, transcript variant A (Tm2), mRNA 
0   NM_058080.2  CG3747-RA, transcript variant A (Eaat1), mRNA 
0   NM_169644.1  CG4843-RB, transcript variant B (Tm2), mRNA 
0   NM_164853.1  CG3747-RB, transcript variant B (Eaat1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.