National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9296R-2 
 Symbol CG9296  Full Name CG9296 
 CG No CG9296  Old CG No CG9296 
 Synonyms CG9296 
 Accession No (Link to NCBI) NM_135402.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGCTCCGACGACCAGAGT 
 Primer Seq. 3'
aatctagaggtaccGTAGTACAGGCGCACAACCGA 
 Predicted Fragment Size
450 
 IR fragment full Seq
0001 ATGGGCTCCG ACGACCAGAG TGCCGGGGAC AGGATCCAGA AGGGATTCCA GATCAACTAT 
0061 ATGATTCTGC GGGATGCCGA CAGCGGAAAA ATAATCTGGC AGGAGAACAA GGACTTNCTC 
0121 GGCACCGGAC CAGGAGCATG AGGCCCGAGT GCCGGTGAAA ATACTCGACA TGCGTGCCGT 
0181 TTCCCGGGAG ATCAACTTCA GCACCATCGA GTCGATGGAG NAACTTTCGC CTGGACCAGA 
0241 AGGTGCTCTT CAAGGGCCGC ATCATGGAGG AGTGGTTCTT TGAGATGGGA TTCGTGGGTG 
0301 CCAACACCAC CAACACCTGG CAGTCGACAA TCGAGGCGGC ACCCGAATCC CAGATGATGC 
0361 CTGCCAAGGT CNTTGAACGG CAATGTGACT ATCCAAACCA GTTTCTACGA CAACGAGACA 
0421 CTCATCACCA AATCGGTTGT GCGCCTGTAC TAC 
 in silico PCR Fragment
0001 ATGGGCTCCG ACGACCAGAG TGCCGGGGAC AGGATCCAGA AGGGATTCCA GATCAACTAT 
0061 ATGATTCTGC GGGATGCCGA CAGCGGAAAA ATAATCTGGC AGGAGAACAA GGACTT-CTC 
0121 GGCACCGGAC CAGGAGCATG AGGCCCGAGT GCCGGTGAAA ATACTCGACA TGCGTGCCGT 
0181 TTCCCGGGAG ATCAACTTCA GCACCATCGA GTCGATGGAG -AACTTTCGC CTGGACCAGA 
0241 AGGTGCTCTT CAAGGGCCGC ATCATGGAGG AGTGGTTCTT TGAGATGGGA TTCGTGGGTG 
0301 CCAACACCAC CAACACCTGG CAGTCGACAA TCGAGGCGGC ACCCGAATCC CAGATGATGC 
0361 CTGCCAAGGT C-TTGAACGG CAATGTGACT ATCCAAACCA GTTTCTACGA CAACGAGACA 
0421 CTCATCACCA AATCGGTTGT GCGCCTGTAC TAC 
 Assemble Data

9296R-2.IR_full       1   ATGGGCTCCGACGACCAGAGTGCCGGGGACAGGATCCAGAAGGGATTCCAGATCAACTAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9296R-2.in silico     1   ATGGGCTCCGACGACCAGAGTGCCGGGGACAGGATCCAGAAGGGATTCCAGATCAACTAT 60


9296R-2.IR_full       61  ATGATTCTGCGGGATGCCGACAGCGGAAAAATAATCTGGCAGGAGAACAAGGACTTNCTC 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
9296R-2.in silico     61  ATGATTCTGCGGGATGCCGACAGCGGAAAAATAATCTGGCAGGAGAACAAGGACTT-CTC 120


9296R-2.IR_full       121 GGCACCGGACCAGGAGCATGAGGCCCGAGTGCCGGTGAAAATACTCGACATGCGTGCCGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9296R-2.in silico     121 GGCACCGGACCAGGAGCATGAGGCCCGAGTGCCGGTGAAAATACTCGACATGCGTGCCGT 180


9296R-2.IR_full       181 TTCCCGGGAGATCAACTTCAGCACCATCGAGTCGATGGAGNAACTTTCGCCTGGACCAGA 240
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
9296R-2.in silico     181 TTCCCGGGAGATCAACTTCAGCACCATCGAGTCGATGGAG-AACTTTCGCCTGGACCAGA 240


9296R-2.IR_full       241 AGGTGCTCTTCAAGGGCCGCATCATGGAGGAGTGGTTCTTTGAGATGGGATTCGTGGGTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9296R-2.in silico     241 AGGTGCTCTTCAAGGGCCGCATCATGGAGGAGTGGTTCTTTGAGATGGGATTCGTGGGTG 300


9296R-2.IR_full       301 CCAACACCACCAACACCTGGCAGTCGACAATCGAGGCGGCACCCGAATCCCAGATGATGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9296R-2.in silico     301 CCAACACCACCAACACCTGGCAGTCGACAATCGAGGCGGCACCCGAATCCCAGATGATGC 360


9296R-2.IR_full       361 CTGCCAAGGTCNTTGAACGGCAATGTGACTATCCAAACCAGTTTCTACGACAACGAGACA 420
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
9296R-2.in silico     361 CTGCCAAGGTC-TTGAACGGCAATGTGACTATCCAAACCAGTTTCTACGACAACGAGACA 420


9296R-2.IR_full       421 CTCATCACCAAATCGGTTGTGCGCCTGTACTAC 453
                          |||||||||||||||||||||||||||||||||
9296R-2.in silico     421 CTCATCACCAAATCGGTTGTGCGCCTGTACTAC 453

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   432  NM_135402.2  CG9296-RA (CG9296), mRNA 
0.23   NM_137405.2  CG6424-RB, transcript variant B (CG6424), mRNA 
0.23   NM_166246.1  CG6424-RA, transcript variant A (CG6424), mRNA 
0.23   NM_079577.3  CG6281-RA, transcript variant A (Timp), mRNA 
0.23   NM_169336.2  CG6281-RB, transcript variant B (Timp), mRNA 
0   NM_079639.4  CG31478-RA (mRpL9), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_142259.2  CG10278-RA (GATAe), mRNA 
0   NM_165856.1  CG8290-RA, transcript variant A (CG8290), mRNA 
0   NM_136872.2  CG8290-RB, transcript variant B (CG8290), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   11  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_058037.3  CG9677-RA (Int6), mRNA 
0   NM_137005.1  CG4643-RA, transcript variant A (CG4643), mRNA 
0   NM_165973.1  CG4643-RB, transcript variant B (CG4643), mRNA 
0   NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_169057.1  CG31547-RB, transcript variant B (CG31547), mRNA 
0   NM_169058.1  CG31547-RA, transcript variant A (CG31547), mRNA 
0   NM_057473.3  CG8987-RA (tam), mRNA 
0   NM_134677.1  CG13690-RA (CG13690), mRNA 
0   NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_164985.1  CG6756-RB, transcript variant B (Tom70), mRNA 
0   NM_135692.1  CG6756-RA, transcript variant A (Tom70), mRNA 
0   NM_164986.1  CG6756-RC, transcript variant C (Tom70), mRNA 
0   NM_133031.1  CG6847-RA (CG6847), mRNA 
0   NM_057486.3  CG2939-RA (slp2), mRNA 
0   NM_137558.2  CG11906-RA (CG11906), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
VM
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.