National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9193R-1 
 Symbol mus209  Full Name mutagen-sensitive 209 
 CG No CG9193  Old CG No CG9193 
 Synonyms Mus209, DmPCNA, pcna, PCNA/mus209, PCNA, Pcna, l(2)02448, 53/13, l(2)s1534, l(2)56Fa, l(2)56F, CG9193, mus209, dPCNA 
 Accession No (Link to NCBI) NM_057557.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zhou L, Luo H.
Replication protein a links cell cycle progression and the onset of neurogenesis in Drosophila optic lobe development.
J. Neurosci. (2013) 33(7) 2873-88 [ PubMed ID = 23407946 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTTCGAGGCACGCCTGGGT 
 Primer Seq. 3'
aatctagaggtaccGCCCTCCTTGGTGCAGCAGAT 
 Predicted Fragment Size
498 
 IR fragment full Seq
0001 ATGTTCGAGG CACGCCTGGG TCAAGCCACC ATCCTGAAGA AGATCTTGGA TGCCATCAAG 
0061 GATCTGCTCA ATGAGGCAAC CTTCGATTGC AGCGACTCCG GCATTCAGCT ACAGGCCATG 
0121 GACAACTCCC ATGTGTCGCT TGTCTCGCTG ACCCTGCGTT CCGATGGCTT CGACAAGTTT 
0181 CGCTGCGACC GCAATCTCTC CATGGGCATG AATCTGGGCA GCATGGCCAA GATTCTGAAA 
0241 TGCGCCAACA ACGAGGACAA TGTGACGATG AAGGCGCAGG ATAACGCCGA CACTGTCACC 
0301 ATCATGTTCG AATCGGCTAA CCAGGAGAAG GTATCGGACT ACGAGATGAA ACTGATGAAC 
0361 CTCGACCAGG AGCACCTGGG CATACCGGAG ACAGACTTCT CGTGCGTGGT CCGCATGCCG 
0421 GCCATGGAGT TCGCTCGCAT CTGCCGCGAT CTGGCGCAGT TCAGCGAATC CGTTGTGATC 
0481 TGCTGCACCA AGGAGGGC 
 in silico PCR Fragment
0001 ATGTTCGAGG CACGCCTGGG TCAAGCCACC ATCCTGAAGA AGATCTTGGA TGCCATCAAG 
0061 GATCTGCTCA ATGAGGCAAC CTTCGATTGC AGCGACTCCG GCATTCAGCT ACAGGCCATG 
0121 GACAACTCCC ATGTGTCGCT TGTCTCGCTG ACCCTGCGTT CCGATGGCTT CGACAAGTTT 
0181 CGCTGCGACC GCAATCTCTC CATGGGCATG AATCTGGGCA GCATGGCCAA GATTCTGAAA 
0241 TGCGCCAACA ACGAGGACAA TGTGACGATG AAGGCGCAGG ATAACGCCGA CACTGTCACC 
0301 ATCATGTTCG AATCGGCTAA CCAGGAGAAG GTATCGGACT ACGAGATGAA ACTGATGAAC 
0361 CTCGACCAGG AGCACCTGGG CATACCGGAG ACAGACTTCT CGTGCGTGGT CCGCATGCCG 
0421 GCCATGGAGT TCGCTCGCAT CTGCCGCGAT CTGGCGCAGT TCAGCGAATC CGTTGTGATC 
0481 TGCTGCACCA AGGAGGGC 
 Assemble Data

9193R-1.IR_full       1   ATGTTCGAGGCACGCCTGGGTCAAGCCACCATCCTGAAGAAGATCTTGGATGCCATCAAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     1   ATGTTCGAGGCACGCCTGGGTCAAGCCACCATCCTGAAGAAGATCTTGGATGCCATCAAG 60


9193R-1.IR_full       61  GATCTGCTCAATGAGGCAACCTTCGATTGCAGCGACTCCGGCATTCAGCTACAGGCCATG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     61  GATCTGCTCAATGAGGCAACCTTCGATTGCAGCGACTCCGGCATTCAGCTACAGGCCATG 120


9193R-1.IR_full       121 GACAACTCCCATGTGTCGCTTGTCTCGCTGACCCTGCGTTCCGATGGCTTCGACAAGTTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     121 GACAACTCCCATGTGTCGCTTGTCTCGCTGACCCTGCGTTCCGATGGCTTCGACAAGTTT 180


9193R-1.IR_full       181 CGCTGCGACCGCAATCTCTCCATGGGCATGAATCTGGGCAGCATGGCCAAGATTCTGAAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     181 CGCTGCGACCGCAATCTCTCCATGGGCATGAATCTGGGCAGCATGGCCAAGATTCTGAAA 240


9193R-1.IR_full       241 TGCGCCAACAACGAGGACAATGTGACGATGAAGGCGCAGGATAACGCCGACACTGTCACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     241 TGCGCCAACAACGAGGACAATGTGACGATGAAGGCGCAGGATAACGCCGACACTGTCACC 300


9193R-1.IR_full       301 ATCATGTTCGAATCGGCTAACCAGGAGAAGGTATCGGACTACGAGATGAAACTGATGAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     301 ATCATGTTCGAATCGGCTAACCAGGAGAAGGTATCGGACTACGAGATGAAACTGATGAAC 360


9193R-1.IR_full       361 CTCGACCAGGAGCACCTGGGCATACCGGAGACAGACTTCTCGTGCGTGGTCCGCATGCCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     361 CTCGACCAGGAGCACCTGGGCATACCGGAGACAGACTTCTCGTGCGTGGTCCGCATGCCG 420


9193R-1.IR_full       421 GCCATGGAGTTCGCTCGCATCTGCCGCGATCTGGCGCAGTTCAGCGAATCCGTTGTGATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9193R-1.in silico     421 GCCATGGAGTTCGCTCGCATCTGCCGCGATCTGGCGCAGTTCAGCGAATCCGTTGTGATC 480


9193R-1.IR_full       481 TGCTGCACCAAGGAGGGC 498
                          ||||||||||||||||||
9193R-1.in silico     481 TGCTGCACCAAGGAGGGC 498

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   480  NM_206182.1  CG9193-RB, transcript variant B (mus209), mRNA 
100   480  NM_057557.3  CG9193-RA, transcript variant A (mus209), mRNA 
0   NM_176751.1  CG8557-RB, transcript variant B (CG8557), mRNA 
0   NM_132990.2  CG8557-RA, transcript variant A (CG8557), mRNA 
0   NM_169884.1  CG31210-RA (CG31210), mRNA 
0   NM_142599.1  CG4836-RC, transcript variant C (CG4836), mRNA 
0   NM_169883.1  CG4836-RA, transcript variant A (CG4836), mRNA 
0   NM_169882.1  CG4836-RB, transcript variant B (CG4836), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   15  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_141611.1  CG9746-RA (CG9746), mRNA 
0   NM_079771.1  CG11921-RA (fd96Ca), mRNA 
0   NM_135735.1  CG5525-RA (CG5525), mRNA 
0   NM_137707.2  CG30388-RA (Magi), mRNA 
0   NM_143047.2  CG3744-RA, transcript variant A (CG3744), mRNA 
0   NM_206569.1  CG3744-RC, transcript variant C (CG3744), mRNA 
0   NM_001015400.1  CG40410-PA.3 (CG40410), mRNA 
0   NM_170177.2  CG3744-RB, transcript variant B (CG3744), mRNA 
0   NM_138069.2  CG4563-RA (CG4563), mRNA 
0   NM_080055.2  CG3895-RA (ph-d), mRNA 
0   NM_078963.2  CG7576-RA (Rab3), mRNA 
0   NM_176745.1  CG5424-RD, transcript variant D (f), mRNA 
0   NM_078660.2  CG5424-RB, transcript variant B (f), mRNA 
0   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   NM_078983.2  CG8439-RA, transcript variant A (Cct5), mRNA 
0   NM_165867.1  CG8439-RB, transcript variant B (Cct5), mRNA 
0   NM_139777.1  CG7376-RA (CG7376), mRNA 
0   NM_206301.1  CG7986-RC, transcript variant C (Atg18), mRNA 
0   NM_139927.2  CG7986-RA, transcript variant A (Atg18), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.