National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9169R-3 
 Symbol FucTD  Full Name FucTD 
 CG No CG9169  Old CG No CG9169 
 Synonyms CG9169, FucTD 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCGATAGACAGACTCCGT 
 Primer Seq. 3'
aatctagaggtaccCTGATGACCACTGCATCGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

9169R-3.IR full       1   ATGCCGATAGACAGAC--CGTCCATTGCCGGTGGAGAAGCTACTGAGCTTCCGAAGGAAT 60
                          ||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||
9169R-3.in silico     1   ATGCCGATAGACAGACTCCGTCCATTGCCGGTGGAGAAGCTACTGAGCTTCCGAAGGAAT 60


9169R-3.IR full       61  CCCGATCTGCTGCAGCAACATCGACAGCAGACCGATGAAATGGAGGCCATACCGAAGTTT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9169R-3.in silico     61  CCCGATCTGCTGCAGCAACATCGACAGCAGACCGATGAAATGGAGGCCATACCGAAGTTT 120


9169R-3.IR full       121 TTGCCATCCCGACTCCTTCCGGACGACGAAGATGCCAAGGTTGGAAGTCGCAGGATGGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9169R-3.in silico     121 TTGCCATCCCGACTCCTTCCGGACGACGAAGATGCCAAGGTTGGAAGTCGCAGGATGGCG 180


9169R-3.IR full       181 GATAACGATGAGGATNCC-TTCGGCTGCCTCCTCCACGAAGATCTCCGGTCTCGATGAGA 240
                          ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||
9169R-3.in silico     181 GATAACGATGAGGATACCCTTCGGCTGCCTCCTCCACGAAGATCTCCGGTCTCGATGAGA 240


9169R-3.IR full       241 AATCTCCAGCGGGAGTTGTACTCGCCCATTCAGTGTATGAATGCTCTCAAAGTCATGGCC 300
                          |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||
9169R-3.in silico     241 AATCTCCAACGGGAGTTGTATTCGCCCATTCAGTGTATGAATGCTCTCAAAGTCATGGCC 300


9169R-3.IR full       301 GTCGTGCTAACCATTTGCTTGGTGTTCACCACGATTCCATTATTACGCCGTCAAACTATG 360
                          ||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||
9169R-3.in silico     301 GTCGTGCTAACCATTTGCTTGGTGTTCACCACGATACCACTATTACGCCGTCAAACTATG 360


9169R-3.IR full       361 CAGGAGAATGATAATCTTCGGATGATCCTTCTGTGGAATGAGCCTAGTAGCCTAGTAGAT 420
                          ||||||| ||||||||||||||||||||||||||||||||||||    ||||||||| ||
9169R-3.in silico     361 CAGGAGAGTGATAATCTTCGGATGATCCTTCTGTGGAATGAGCCA---AGCCTAGTAAAT 420


9169R-3.IR full       421 GCACCNGCGCACNTGGAGTGTGGCTNCCNNGTTACCACCAGCCGGAGTCACAATGACAAA 480
                          ||||| |||||| |||||||||||| ||  || |||||||||||||||||||||||||||
9169R-3.in silico     421 GCACCAGCGCACGTGGAGTGTGGCTGCCTGGTCACCACCAGCCGGAGTCACAATGACAAA 480


9169R-3.IR full       481 GCTTTCGATGCAGTGGTCATCA- 503
                          |||||||||||||||||||||| 
9169R-3.in silico     481 GCTTTCGATGCAGTGGTCATCAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_138263.1  FucTD CG9169-RA (FucTD), mRNA 
0.2  NM_168461.2  Mob1 CG11711-RA, transcript variant A (Mob1), mRNA 
0.2  NM_137096.2  CG8468-RB, transcript variant B (CG8468), mRNA 
0.2  NM_166038.1  CG8468-RA, transcript variant A (CG8468), mRNA 
0.2  NM_166039.1  CG8468-RC, transcript variant C (CG8468), mRNA 
10  NM_143154.3  CG5053-RA (CG5053), mRNA 
NM_206084.2  longitudinals lacking CG12052-RW, transcript variant W (lola), mRNA 
NM_176128.3  longitudinals lacking CG12052-RN, transcript variant N (lola), mRNA 
10  NM_170658.2  minibrain CG7826-RC, transcript variant C (mnb), mRNA 
10  NM_001014750.1  minibrain CG7826-RD, transcript variant D (mnb), mRNA 
NM_165965.1  CG3884-RA, transcript variant A (CG3884), mRNA 
12  NM_137196.1  CG12964-RA (CG12964), mRNA 
25  NM_168571.2  CG32133-RA (CG32133), mRNA 
NM_143196.1  CG8968-RA (CG8968), mRNA 
NM_135309.1  CG7134-RA (CG7134), mRNA 
NM_137371.2  CG6522-RA (CG6522), mRNA 
21  NM_139495.1  CG9973-RA (CG9973), mRNA 
28  NM_078797.2  taiman CG13109-RA (tai), mRNA 
26  NM_169783.1  couch potato CG31243-RB, transcript variant B (cpo), mRNA 
26  NM_169781.1  couch potato CG31243-RE, transcript variant E (cpo), mRNA 
26  NM_169782.1  couch potato CG31243-RA, transcript variant A (cpo), mRNA 
22  NM_164424.1  CG18131-RC, transcript variant C (CG18131), mRNA 
22  NM_164421.1  CG18131-RF, transcript variant F (CG18131), mRNA 
22  NM_164422.1  CG18131-RE, transcript variant E (CG18131), mRNA 
22  NM_164425.1  CG18131-RB, transcript variant B (CG18131), mRNA 
22  NM_134757.4  CG18131-RD, transcript variant D (CG18131), mRNA 
22  NM_164423.1  CG18131-RA, transcript variant A (CG18131), mRNA 
15  NM_132351.1  Sp1 CG1343-RA, transcript variant A (Sp1), mRNA 
15  NM_167200.1  Sp1 CG1343-RB, transcript variant B (Sp1), mRNA 
12  NM_168361.1  CG16711-RB, transcript variant B (CG16711), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.