National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9148R-2 
 Symbol scf  Full Name supercoiling factor 
 CG No CG9148  Old CG No CG9148 
 Synonyms SCF, DCB-45, CK02682, anon-EST:Posey14, CG9148, BEST:CK02682, scf 
 Accession No (Link to NCBI) NM_058044.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGAATTCAGATGCTGCTACT 
 Primer Seq. 3'
aatctagaggtaccAGCAGGCTCTTGTAGCTGACT 
 Predicted Fragment Size
486 
 IR fragment full Seq
0001 CCGAATTCAG ATGCTGCTAC TTGTTGTTGC GCTGACGGCG GTGATAAGTG GAGCAAGTGC 
0061 CTCCAGCATA CCGGAAGAGC TGCCCCACAA TCCGCTCGAG CACGACCCCC TGCACCCCAG 
0121 GCACTTCGAC GGGGGCGAGC ACAATGCCCA GTTTGACCAC GAAGCCTTCT TGGGCCCGGA 
0181 CGAGTCCAAG AAGTTCGACA GCCTGACACC CGAGGAGAGC AGGCGGAGAT TGGGCGTCAT 
0241 TGTGGACCGA ATCGACGAGA ACAAGGACGG GTCAGTCACA TTGGCGGAGC TANAAGAACT 
0301 GGATCGCCTA CACCCAGAGG CGCTACATCG AAGAAGACGT GGGTCGCGTG TGGAAGCAGC 
0361 ACAATCCGGA CAACAATGAG ACCATAAGCT GGGATTCCTA CATGCAGACT GTCTACGGCT 
0421 TCATGGATGA TCTGAGCCCC GACGAGAAGG AACAGGAGGA AAATGGAGTC AGCTACAAGA 
0481 GCCTGCT 
 in silico PCR Fragment
0001 CCGAATTCAG ATGCTGCTAC TTGTTGTTGC GCTGACGGCG GTGATAAGTG GAGCAAGTGC 
0061 CTCCAGCATA CCGGAAGAGC TGCCCCACAA TCCGCTCGAG CACGACCCCC TGCACCCCAG 
0121 GCACTTCGAC GGGGGCGAGC ACAATGCCCA GTTTGACCAC GAAGCCTTCT TGGGCCCGGA 
0181 CGAGTCCAAG AAGTTCGACA GCCTGACACC CGAGGAGAGC AGGCGGAGAT TGGGCGTCAT 
0241 TGTGGACCGA ATCGACGAGA ACAAGGACGG GTCAGTCACA TTGGCGGAGC TA-AAGAACT 
0301 GGATCGCCTA CACCCAGAGG CGCTACATCG AAGAAGACGT GGGTCGCGTG TGGAAGCAGC 
0361 ACAATCCGGA CAACAATGAG ACCATAAGCT GGGATTCCTA CATGCAGACT GTCTACGGCT 
0421 TCATGGATGA TCTGAGCCCC GACGAGAAGG AACAGGAGGA AAATGGAGTC AGCTACAAGA 
0481 GCCTGCT 
 Assemble Data

9148R-2.IR_full       1   CCGAATTCAGATGCTGCTACTTGTTGTTGCGCTGACGGCGGTGATAAGTGGAGCAAGTGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9148R-2.in silico     1   CCGAATTCAGATGCTGCTACTTGTTGTTGCGCTGACGGCGGTGATAAGTGGAGCAAGTGC 60


9148R-2.IR_full       61  CTCCAGCATACCGGAAGAGCTGCCCCACAATCCGCTCGAGCACGACCCCCTGCACCCCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9148R-2.in silico     61  CTCCAGCATACCGGAAGAGCTGCCCCACAATCCGCTCGAGCACGACCCCCTGCACCCCAG 120


9148R-2.IR_full       121 GCACTTCGACGGGGGCGAGCACAATGCCCAGTTTGACCACGAAGCCTTCTTGGGCCCGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9148R-2.in silico     121 GCACTTCGACGGGGGCGAGCACAATGCCCAGTTTGACCACGAAGCCTTCTTGGGCCCGGA 180


9148R-2.IR_full       181 CGAGTCCAAGAAGTTCGACAGCCTGACACCCGAGGAGAGCAGGCGGAGATTGGGCGTCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9148R-2.in silico     181 CGAGTCCAAGAAGTTCGACAGCCTGACACCCGAGGAGAGCAGGCGGAGATTGGGCGTCAT 240


9148R-2.IR_full       241 TGTGGACCGAATCGACGAGAACAAGGACGGGTCAGTCACATTGGCGGAGCTANAAGAACT 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
9148R-2.in silico     241 TGTGGACCGAATCGACGAGAACAAGGACGGGTCAGTCACATTGGCGGAGCTA-AAGAACT 300


9148R-2.IR_full       301 GGATCGCCTACACCCAGAGGCGCTACATCGAAGAAGACGTGGGTCGCGTGTGGAAGCAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9148R-2.in silico     301 GGATCGCCTACACCCAGAGGCGCTACATCGAAGAAGACGTGGGTCGCGTGTGGAAGCAGC 360


9148R-2.IR_full       361 ACAATCCGGACAACAATGAGACCATAAGCTGGGATTCCTACATGCAGACTGTCTACGGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9148R-2.in silico     361 ACAATCCGGACAACAATGAGACCATAAGCTGGGATTCCTACATGCAGACTGTCTACGGCT 420


9148R-2.IR_full       421 TCATGGATGATCTGAGCCCCGACGAGAAGGAACAGGAGGAAAATGGAGTCAGCTACAAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9148R-2.in silico     421 TCATGGATGATCTGAGCCCCGACGAGAAGGAACAGGAGGAAAATGGAGTCAGCTACAAGA 480


9148R-2.IR_full       481 GCCTGCT 487
                          |||||||
9148R-2.in silico     481 GCCTGCT 487

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   468  NM_058044.4  CG9148-RA, transcript variant A (scf), mRNA 
100   468  NM_206231.1  CG9148-RC, transcript variant C (scf), mRNA 
68.16   319  NM_058045.4  CG9148-RB, transcript variant B (scf), mRNA 
0.21   NM_079586.2  CG6598-RA (Fdh), mRNA 
0   NM_139720.2  CG5150-RA (CG5150), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_135400.1  CG9287-RA (CG9287), mRNA 
0   NM_206430.1  CG2666-RC, transcript variant C (kkv), mRNA 
0   NM_079509.1  CG2666-RA, transcript variant A (kkv), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
0   NM_143318.2  CG31057-RA (tau), mRNA 
0   NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
0   NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
0   NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_141833.2  CG6791-RB, transcript variant B (CG6791), mRNA 
0   NM_166554.1  CG3612-RA (blw), mRNA 
0   NM_135440.1  CG4450-RA (CG4450), mRNA 
0   NM_169851.1  CG31475-RA (CG31475), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_142585.1  CG4733-RA (CG4733), mRNA 
0   NM_166293.1  CG17725-RB, transcript variant B (Pepck), mRNA 
0   NM_141690.1  CG12947-RA (CG12947), mRNA 
0   NM_079813.2  CG12261-RA (mRpS22), mRNA 
0   19  39  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_206458.2  CG17816-RD, transcript variant D (CG17816), mRNA 
0   NM_169199.1  CG17816-RA, transcript variant A (CG17816), mRNA 
0   NM_169198.1  CG17816-RB, transcript variant B (CG17816), mRNA 
0   NM_141487.2  CG17816-RC, transcript variant C (CG17816), mRNA 
0   NM_140754.1  CG5582-RA (cln3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.