National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9109R-3 
 Symbol CG9109  Full Name CG9109 
 CG No CG9109  Old CG No CG9109 
 Synonyms CG9109 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATATGTGTGCTGTTTGGGCT 
 Primer Seq. 3'
aatctagaggtaccTGAAAACGACTCCGGCACTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

9109R-3.IR full       1   GATATGTGTGCTGTTTGGGCTTCTGTGCCTCGCAAGCTTATGCTGCGGTAGTAACAAGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9109R-3.in silico     1   GATATGTGTGCTGTTTGGGCTTCTGTGCCTCGCAAGCTTATGCTGCGGTAGTAACAAGCC 60


9109R-3.IR full       61  AGGAGAGGTGCTCCTGGTTATCGCCTGTCCCCCGCATCCTCAGCAGGCCAGAAGTGATTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9109R-3.in silico     61  AGGAGAGGTGCTCCTGGTTATCGCCTGTCCCCCGCATCCTCAGCAGGCCAGAAGTGATTG 120


9109R-3.IR full       121 TTTAGCCTTATCGCACAACGTGCTGGAGCAGCAACGGGCACTGGAACTGGCGGGGATCTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9109R-3.in silico     121 TTTAGCCTTATCGCACAACGTGCTGGAGCAGCAACGGGCACTGGAACTGGCGGGGATCTT 180


9109R-3.IR full       181 CCCCGAGGACTTTGTCCTGAAGGTCCATGTGATGCATGAGCTCTTTAACTCCTGGACCAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9109R-3.in silico     181 CCCCGAGGACTTTGTCCTGAAGGTCCATGTGATGCATGAGCTCTTTAACTCCTGGACCAT 240


9109R-3.IR full       241 GCTGGACGCACTGCCTCATCTAAGAGCCCAGGCACGTGTGCTGGGTGCGCGCACGGAATG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9109R-3.in silico     241 GCTGGACGCACTGCCTCATCTAAGAGCCCAGGCACGTGTGCTGGGTGCGCGCACGGAATG 300


9109R-3.IR full       301 GATTATATGGTGTCAACACAACACGCGTGTGTCTTCGCTGCGCGGCCTGCTCGAGCAACT 360
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
9109R-3.in silico     301 GATTATATGGTGTCAACACAACACGCGTGTGTCTTCGTTGCGCGGCCTGCTCGAGCAACT 360


9109R-3.IR full       361 GCGTCGCCAGAACCCAAGGGAGCTAGCTTTCTATGGGCACGCCCTTTACGATGCGGAGGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9109R-3.in silico     361 GCGTCGCCAGAACCCAAGGGAGCTAGCTTTCTATGGGCACGCCCTTTACGATGCGGAGGC 420


9109R-3.IR full       421 AACCATCATCCACCACTTCTCGAACTACAAGGATCCCCAGCGGTTTCCATATCCCATGCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9109R-3.in silico     421 AACCATCATCCACCACTTCTCGAACTACAAGGATCCCCAGCGGTTTCCATATCCCATGCT 480


9109R-3.IR full       481 CAGTGCCGGAGTCGTTTTCA 500
                          ||||||||||||||||||||
9109R-3.in silico     481 CAGTGCCGGAGTCGTTTTCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_001038790.1  CG9109-RB, transcript variant B (CG9109), mRNA 
100  482  NM_135138.3  CG9109-RA, transcript variant A (CG9109), mRNA 
0.2  NM_079810.4  barentsz CG12878-RA, transcript variant A (btz), mRNA 
0.2  NM_170350.1  barentsz CG12878-RB, transcript variant B (btz), mRNA 
NM_206800.1  bves CG32513-RB, transcript variant B (bves), mRNA 
NM_134582.2  bves CG32513-RA, transcript variant A (bves), mRNA 
NM_143011.1  CG6631-RA, transcript variant A (CG6631), mRNA 
NM_133037.2  CG7536-RA, transcript variant A (CG7536), mRNA 
NM_167599.1  CG7536-RB, transcript variant B (CG7536), mRNA 
NM_132086.1  CG15894-RA (CG15894), mRNA 
NM_132437.1  CG15207-RA (CG15207), mRNA 
NM_141490.1  CG2943-RA (CG2943), mRNA 
NM_079785.2  E(spl) region transcript m3 CG8346-RA (HLHm3), mRNA 
NM_164924.1  CG31716-RG, transcript variant G (CG31716), mRNA 
NM_164920.1  CG31716-RB, transcript variant B (CG31716), mRNA 
NM_164922.1  CG31716-RD, transcript variant D (CG31716), mRNA 
NM_141363.1  CG15589-RA (CG15589), mRNA 
NM_164921.1  CG31716-RC, transcript variant C (CG31716), mRNA 
NM_164923.1  CG31716-RE, transcript variant E (CG31716), mRNA 
NM_164919.1  CG31716-RA, transcript variant A (CG31716), mRNA 
NM_132102.1  CG14443-RA (CG14443), mRNA 
NM_080528.2  falten CG9670-RA (fal), mRNA 
NM_135755.1  CG9932-RA (CG9932), mRNA 
NM_132539.2  Upf1 CG1559-RA (Upf1), mRNA 
NM_130492.2  CG13366-RA, transcript variant A (CG13366), mRNA 
NM_001042789.1  CG13366-RB, transcript variant B (CG13366), mRNA 
NM_164832.1  Glutactin CG9280-RC, transcript variant C (Glt), mRNA 
NM_164831.1  Glutactin CG9280-RB, transcript variant B (Glt), mRNA 
NM_058156.2  Glutactin CG9280-RA, transcript variant A (Glt), mRNA 
NM_079921.2  small bristles CG1664-RA (sbr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.