National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9093R-3 
 Symbol Tsp26A  Full Name Tetraspanin 26A 
 CG No CG9093  Old CG No CG9093 
 Synonyms CG9093, Dm.Tsp26A, Tsp26A, Tetraspanin 26A 
 Accession No (Link to NCBI) NM_078763.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Jeibmann A, Halama K, Witte HT, Kim SN, Eikmeier K, Koos B, Klämbt C, Paulus W.
Involvement of CD9 and PDGFR in migration is evolutionarily conserved from Drosophila glia to human glioma.
J. Neurooncol. (2015) 124(3) 373-83 [ PubMed ID = 26224160 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAAATCAGCTGCTGTCTGAAG 
 Primer Seq. 3'
aatctagaggtaccGCGATAGACGAGCAATTGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAAATCAGCT GCTGTCTGAA GTACCTTTTG TTCGCCAGCA ATGTGATCCT GTGGCTCNTC 
0061 GGcCCTGCTG GTCCTCTCCG TTGGCATCTG GGCCTGGAGC GAGAAGGGCA TGTTCCGCAA 
0121 CATTGCGCGG CTGCACTTCA TCGCCCTGGA CCCGGCCTTC GTCCTGATCA TCCTGGGAGG 
0181 CGTCACCTTC CTACTGGGCT TCATGGGCAG CGTGGGCNGc CTTGCGCGAG AACACCTGCC 
0241 TCCTgGNGGC GTACGCCATC TTCTTGAGTG TCTTgCTTAT CGCAGAGATC GGCTTCTGTG 
0301 CCGTGGCCTT CGTGCTCAAG GACAAGGGCT GGATCAAAGA CCAGGCCACC GAGGGACTCA 
0361 AGGCCTTCAT TCGCCACTAT CgNGAGGACG CAGACCAGCA GAATCTCATT GATTGGATCC 
0421 AGGAGGATTG GTTGCAGTGT TGCGGCATTG ATgGTCCCAA GGACTGGGAC AGCAACAACT 
0481 ACTTCAATTG CTCGTcTATN GN 
 in silico PCR Fragment
0001 GAAATCAGCT GCTGTCTGAA GTACCTTTTG TTCGCCAGCA ATGTGATCCT GTGGCTC-TC 
0061 GGCCCTGCTG GTCCTCTCCG TTGGCATCTG GGCCTGGAGC GAGAAGGGCA TGTTCCGCAA 
0121 CATTGCGCGG CTGCACTTCA TCGCCCTGGA CCCGGCCTTC GTCCTGATCA TCCTGGGAGG 
0181 CGTCACCTTC CTACTGGGCT TCATGGGCAG CGTGGGC-GC CTTGCGCGAG AACACCTGCC 
0241 TCCTGGGGGC GTACGCCATC TTCTTGAGTG TCTTGCTTAT CGCAGAGATC GGCTTCTGTG 
0301 CCGTGGCCTT CGTGCTCAAG GACAAGGGCT GGATCAAAGA CCAGGCCACC GAGGGACTCA 
0361 AGGCCTTCAT TCGCCACTAT CGCGAGGACG CAGACCAGCA GAATCTCATT GATTGGATCC 
0421 AGGAGGATTG GTTGCAGTGT TGCGGCATTG ATGGTCCCAA GGACTGGGAC AGCAACAACT 
0481 ACTTCAATTG CTCGTCTATC GC 
 Assemble Data

9093R-3.IR_full       1   GAAATCAGCTGCTGTCTGAAGTACCTTTTGTTCGCCAGCAATGTGATCCTGTGGCTCNTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
9093R-3.in silico     1   GAAATCAGCTGCTGTCTGAAGTACCTTTTGTTCGCCAGCAATGTGATCCTGTGGCTC-TC 60


9093R-3.IR_full       61  GGCCCTGCTGGTCCTCTCCGTTGGCATCTGGGCCTGGAGCGAGAAGGGCATGTTCCGCAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9093R-3.in silico     61  GGCCCTGCTGGTCCTCTCCGTTGGCATCTGGGCCTGGAGCGAGAAGGGCATGTTCCGCAA 120


9093R-3.IR_full       121 CATTGCGCGGCTGCACTTCATCGCCCTGGACCCGGCCTTCGTCCTGATCATCCTGGGAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9093R-3.in silico     121 CATTGCGCGGCTGCACTTCATCGCCCTGGACCCGGCCTTCGTCCTGATCATCCTGGGAGG 180


9093R-3.IR_full       181 CGTCACCTTCCTACTGGGCTTCATGGGCAGCGTGGGCNGCCTTGCGCGAGAACACCTGCC 240
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
9093R-3.in silico     181 CGTCACCTTCCTACTGGGCTTCATGGGCAGCGTGGGC-GCCTTGCGCGAGAACACCTGCC 240


9093R-3.IR_full       241 TCCTGGNGGCGTACGCCATCTTCTTGAGTGTCTTGCTTATCGCAGAGATCGGCTTCTGTG 300
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
9093R-3.in silico     241 TCCTGGGGGCGTACGCCATCTTCTTGAGTGTCTTGCTTATCGCAGAGATCGGCTTCTGTG 300


9093R-3.IR_full       301 CCGTGGCCTTCGTGCTCAAGGACAAGGGCTGGATCAAAGACCAGGCCACCGAGGGACTCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9093R-3.in silico     301 CCGTGGCCTTCGTGCTCAAGGACAAGGGCTGGATCAAAGACCAGGCCACCGAGGGACTCA 360


9093R-3.IR_full       361 AGGCCTTCATTCGCCACTATCGNGAGGACGCAGACCAGCAGAATCTCATTGATTGGATCC 420
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
9093R-3.in silico     361 AGGCCTTCATTCGCCACTATCGCGAGGACGCAGACCAGCAGAATCTCATTGATTGGATCC 420


9093R-3.IR_full       421 AGGAGGATTGGTTGCAGTGTTGCGGCATTGATGGTCCCAAGGACTGGGACAGCAACAACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9093R-3.in silico     421 AGGAGGATTGGTTGCAGTGTTGCGGCATTGATGGTCCCAAGGACTGGGACAGCAACAACT 480


9093R-3.IR_full       481 ACTTCAATTGCTCGTCTATNGN 502
                          ||||||||||||||||||| | 
9093R-3.in silico     481 ACTTCAATTGCTCGTCTATCGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078763.1  CG9093-RA (Tsp26A), mRNA 
0   NM_137877.2  CG30265-RA (CG30265), mRNA 
0   NM_137196.1  CG12964-RA (CG12964), mRNA 
0   NM_001014464.1  CG10033-RJ, transcript variant J (for), mRNA 
0   NM_134319.3  CG10033-RD, transcript variant D (for), mRNA 
0   NM_058142.3  CG10033-RE, transcript variant E (for), mRNA 
0   NM_205907.1  CG10033-RG, transcript variant G (for), mRNA 
0   NM_058141.3  CG10033-RC, transcript variant C (for), mRNA 
0   NM_205905.1  CG10033-RF, transcript variant F (for), mRNA 
0   NM_141145.1  CG14455-RA (CG14455), mRNA 
0   NM_166105.1  CG8205-RC, transcript variant C (fus), mRNA 
0   NM_079952.2  CG8205-RD, transcript variant D (fus), mRNA 
0   NM_166108.1  CG8205-RF, transcript variant F (fus), mRNA 
0   NM_166107.1  CG8205-RE, transcript variant E (fus), mRNA 
0   NM_167903.1  CG7955-RB, transcript variant B (CG7955), mRNA 
0   NM_167902.1  CG7955-RA, transcript variant A (CG7955), mRNA 
0   NM_139377.2  CG7955-RC, transcript variant C (CG7955), mRNA 
0   NM_136675.1  CG1625-RA (CG1625), mRNA 
0   NM_143298.1  CG3368-RA (CG3368), mRNA 
0   NM_136043.2  CG10413-RA (CG10413), mRNA 
0   10  NM_079585.2  CG4591-RA (Tsp86D), mRNA 
0   NM_133002.1  CG5800-RA (CG5800), mRNA 
0   NM_134534.2  CG17052-RA (CG17052), mRNA 
0   NM_132081.2  CG15896-RA (CG15896), mRNA 
0   NM_143236.1  CG14248-RA (CG14248), mRNA 
0   NM_141542.1  CG11718-RA (CG11718), mRNA 
0   NM_137484.2  CG17530-RA (GstE6), mRNA 
0   NM_132385.2  CG2967-RA (CG2967), mRNA 
0   NM_132302.3  CG7055-RA (dalao), mRNA 
0   NM_135779.2  CG5648-RA (Prosalpha6T), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.