National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9088R-1 
 Symbol lid  Full Name little imaginal discs 
 CG No CG9088  Old CG No CG9088 
 Synonyms CG9088, l(2)10424, lid, Lid 
 Accession No (Link to NCBI) NM_078762.4 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Morán T, Bernués J, Azorín F.
The Drosophila histone demethylase dKDM5/LID regulates hematopoietic development.
Dev. Biol. (2015) 405(2) 260-8 [ PubMed ID = 26183107 ] [ RRC reference ]

Liefke R, Oswald F, Alvarado C, Ferres-Marco D, Mittler G, Rodriguez P, Dominguez M, Borggrefe T.
Histone demethylase KDM5A is an integral part of the core Notch-RBP-J repressor complex.
Genes Dev. (2010) 24(6) 590-601 [ PubMed ID = 20231316 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAACGGGCAACGGGACTAATA 
 Primer Seq. 3'
aatctagaggtaccCACAAAGCGTAGCTTGTCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAACGGGcAA CGGGACTaAT AGTGGAAGTG AGTCCGTAAA GAAATCCAAT GCTAACGACG 
0061 AGCCCTCGAC CCCAGTCACC CCGGCAGGAG CAACAGGATC TCACAGCCCA TGCTCCGCCA 
0121 GGCATTTCTC CGGCGGTAAT GGAACGGCCT ATGCCCAGTG TTCCCATGAA TCACGCCAGC 
0181 AGCAGTGTGT CAGCCAGCAA AAAGTACCAT AATAGTTGTC CTCATCCCAC GCCCACNGCC 
0241 TGCGCCCACT GGGCACAAGN AAGTCGGTCC ACACGCAGCC GCACAGCAGC AACAAGTTTG 
0301 ACCAGGGAAA GAACGAGGAG TTCCACTTTG ACACGCCGCC AGAGTGCCCT GTGTTCCGGC 
0361 CCACAACTGA GGAGTTCAAG AATCCACTGG CCTACATCAG CAAGATCCGC TCCATAGCTG 
0421 AGAAGTGTGG AATCGCAAAG ATCCTGCCGC CGGCAACCTG GTCGCCGCCG TTTGCAGTGG 
0481 ACGTGAGACA agCNANGCTT TGTG 
 in silico PCR Fragment
0001 CAACGGGCAA CGGGACTAAT AGTGGAAGTG AGTCCGTAAA GAAATCCAAT GCTAACGACG 
0061 AGCCCTCGAC CCCAGTCACC CCGGCAGGAG CAACAGGATC TCACA-CCCA TGCTCCGCCA 
0121 GGCATTTCTC CGGCGGTAAT GGAACGGCCT ATGCCCAGTG TTCCCATGAA TCACGCCAGC 
0181 AGCAGTGTGT CAGCCAGCAA AAAGTACCAT AATAGTTGTC CTCATCCCAC GCCCAC-GCC 
0241 TGCGCCCACT GGGCACAAG- AAGTCGGTCC ACACGCAGCC GCACAGCAGC AACAAGTTTG 
0301 ACCAGGGAAA GAACGAGGAG TTCCACTTTG ACACGCCGCC AGAGTGCCCT GTGTTCCGGC 
0361 CCACAACTGA GGAGTTCAAG AATCCACTGG CCTACATCAG CAAGATCCGC TCCATAGCTG 
0421 AGAAGTGTGG AATCGCAAAG ATCCTGCCGC CGGCAACCTG GTCGCCGCCG TTTGCAGTGG 
0481 ACGTG-GACA AGCTACGCTT TGTG 
 Assemble Data

9088R-1.IR_full       1   CAACGGGCAACGGGACTAATAGTGGAAGTGAGTCCGTAAAGAAATCCAATGCTAACGACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9088R-1.in silico     1   CAACGGGCAACGGGACTAATAGTGGAAGTGAGTCCGTAAAGAAATCCAATGCTAACGACG 60


9088R-1.IR_full       61  AGCCCTCGACCCCAGTCACCCCGGCAGGAGCAACAGGATCTCACAGCCCATGCTCCGCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
9088R-1.in silico     61  AGCCCTCGACCCCAGTCACCCCGGCAGGAGCAACAGGATCTCACA-CCCATGCTCCGCCA 120


9088R-1.IR_full       121 GGCATTTCTCCGGCGGTAATGGAACGGCCTATGCCCAGTGTTCCCATGAATCACGCCAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9088R-1.in silico     121 GGCATTTCTCCGGCGGTAATGGAACGGCCTATGCCCAGTGTTCCCATGAATCACGCCAGC 180


9088R-1.IR_full       181 AGCAGTGTGTCAGCCAGCAAAAAGTACCATAATAGTTGTCCTCATCCCACGCCCACNGCC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
9088R-1.in silico     181 AGCAGTGTGTCAGCCAGCAAAAAGTACCATAATAGTTGTCCTCATCCCACGCCCAC-GCC 240


9088R-1.IR_full       241 TGCGCCCACTGGGCACAAGNAAGTCGGTCCACACGCAGCCGCACAGCAGCAACAAGTTTG 300
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
9088R-1.in silico     241 TGCGCCCACTGGGCACAAG-AAGTCGGTCCACACGCAGCCGCACAGCAGCAACAAGTTTG 300


9088R-1.IR_full       301 ACCAGGGAAAGAACGAGGAGTTCCACTTTGACACGCCGCCAGAGTGCCCTGTGTTCCGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9088R-1.in silico     301 ACCAGGGAAAGAACGAGGAGTTCCACTTTGACACGCCGCCAGAGTGCCCTGTGTTCCGGC 360


9088R-1.IR_full       361 CCACAACTGAGGAGTTCAAGAATCCACTGGCCTACATCAGCAAGATCCGCTCCATAGCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9088R-1.in silico     361 CCACAACTGAGGAGTTCAAGAATCCACTGGCCTACATCAGCAAGATCCGCTCCATAGCTG 420


9088R-1.IR_full       421 AGAAGTGTGGAATCGCAAAGATCCTGCCGCCGGCAACCTGGTCGCCGCCGTTTGCAGTGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9088R-1.in silico     421 AGAAGTGTGGAATCGCAAAGATCCTGCCGCCGGCAACCTGGTCGCCGCCGTTTGCAGTGG 480


9088R-1.IR_full       481 ACGTGAGACAAGCNANGCTTTGTG 504
                          ||||| ||||||| | ||||||||
9088R-1.in silico     481 ACGTG-GACAAGCTACGCTTTGTG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
100   482  NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0   17  34  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   17  34  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_057753.3  CG3283-RA (SdhB), mRNA 
0   NM_140181.1  CG12522-RA (CG12522), mRNA 
0   NM_078865.2  CG6794-RA, transcript variant A (Dif), mRNA 
0   NM_165216.1  CG6794-RB, transcript variant B (Dif), mRNA 
0   NM_078520.2  CG2212-RA, transcript variant A (sws), mRNA 
0   NM_167141.1  CG2212-RB, transcript variant B (sws), mRNA 
0   NM_057950.2  CG2054-RA (Cht2), mRNA 
0   NM_132584.2  CG32654-RC (CG32654), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_132421.2  CG1826-RA (CG1826), mRNA 
0   NM_132686.2  CG32627-RA, transcript variant A (CG32627), mRNA 
0   NM_176726.1  CG32627-RC, transcript variant C (CG32627), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_134304.2  CG9553-RB, transcript variant B (chic), mRNA 
0   NM_164667.2  CG9553-RC, transcript variant C (chic), mRNA 
0   NM_205913.1  CG9553-RD, transcript variant D (chic), mRNA 
0   NM_057668.4  CG9553-RA, transcript variant A (chic), mRNA 
0   NM_169935.1  CG31191-RA (CG31191), mRNA 
0   NM_134931.2  CG31952-RA (CG31952), mRNA 
0   NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0   NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_140162.1  CG18349-RA (CG18349), mRNA 
0   NM_140197.1  CG18490-RB, transcript variant B (CG18490), mRNA 
0   NM_168453.1  CG18490-RC, transcript variant C (CG18490), mRNA 
0   NM_166644.1  CG3832-RB, transcript variant B (Phm), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.