National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9026R-3 
 Symbol CG30022  Full Name CG30022 
 CG No CG30022  Old CG No CG9026 
 Synonyms CG9026, BcDNA:RE56416, CG30022 
 Accession No (Link to NCBI) NM_165830.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGAACCATGAGCCTGCCGGA 
 Primer Seq. 3'
aatctagaggtaccCGTAGAGATTACGTGGGCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGAACCATG AGCCTGCCGG AGCNCCAGcc CTTTTCTCCA GACTTCTTCT TCCGTCAACT 
0061 TTTTGATGGA GAAAGCAGCA CCTATAGCTA CCTTCTGGCC GATCTAAAGA ATGGTCAGGC 
0121 CGTGATCATT GATCCTGTTT TGGAGCAGGC GAAACGAGAT GCCCAGCTGG TCAAGGATCT 
0181 GGGCTTCGAG TTGAAGTATG CCATCAACAC ACACATGCAT GCGGATCACA TAACGGGCAG 
0241 TGGCTGGTTG AGGAAGTTAA CTGGGTGTCA ATCTGTGATT GCTGCCGCCA GTGGAGCCAA 
0301 GGCGGATCGT CACCTGAATG AAGGGGATCG CATAGATTTC GGCACCCATG TGATTGATGC 
0361 TCTGGCCACT CCGGGACACA CAAATGGCTG CATGACCTAT GTGATCAAGG ATCAGGGTTG 
0421 TGTCTTTACC GGAGATACTC TCCTGATACG AGGCTGTGGA CGCACCGATT TCCAGGAAGG 
0481 CTGCCCACCG TAATCTCTAC G 
 in silico PCR Fragment
0001 TGGAACCATG AGCCTGCCGG AGCGCCAGCC CTTTTCTCCA GACTTCTTCT TCCGTCAACT 
0061 TTTTGATGGA GAAAGCAGCA CCTATAGCTA CCTTCTGGCC GATCTAAAGA ATGGTCAGGC 
0121 CGTAATCATT GATCCTGTTT TGGAGCAGGC GAAACGAGAT GCCCAGCTGG TCAAGGATCT 
0181 GGGCTTCGAG TTGAAGTATG CCATCAACAC ACACATGCAT GCGGATCACA TAACGGGCAG 
0241 TGGCTGGTTG AGGAAGTTAA CTGGGTGTCA ATCTGTGATT GCTGCCGCCA GTGGAGCCAA 
0301 GGCGGATCGT CACCTGAATG AAGGGGATCG CATAGATTTC GGCACCCATG TGATTGATGC 
0361 TCTGGCCACT CCGGGACACA CAAATGGCTG CATGACCTAT GTGATCAAGG ATCAGGGTTG 
0421 TGTCTTTACC GGAGATACTC TCCTGATACG AGGCTGTGGA CGCACCGATT TCCAGGAAGG 
0481 CTGCCCA-CG TAATCTCTAC G 
 Assemble Data

9026R-3.IR_full       1   TGGAACCATGAGCCTGCCGGAGCNCCAGCCCTTTTCTCCAGACTTCTTCTTCCGTCAACT 60
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
9026R-3.in silico     1   TGGAACCATGAGCCTGCCGGAGCGCCAGCCCTTTTCTCCAGACTTCTTCTTCCGTCAACT 60


9026R-3.IR_full       61  TTTTGATGGAGAAAGCAGCACCTATAGCTACCTTCTGGCCGATCTAAAGAATGGTCAGGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9026R-3.in silico     61  TTTTGATGGAGAAAGCAGCACCTATAGCTACCTTCTGGCCGATCTAAAGAATGGTCAGGC 120


9026R-3.IR_full       121 CGTGATCATTGATCCTGTTTTGGAGCAGGCGAAACGAGATGCCCAGCTGGTCAAGGATCT 180
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9026R-3.in silico     121 CGTAATCATTGATCCTGTTTTGGAGCAGGCGAAACGAGATGCCCAGCTGGTCAAGGATCT 180


9026R-3.IR_full       181 GGGCTTCGAGTTGAAGTATGCCATCAACACACACATGCATGCGGATCACATAACGGGCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9026R-3.in silico     181 GGGCTTCGAGTTGAAGTATGCCATCAACACACACATGCATGCGGATCACATAACGGGCAG 240


9026R-3.IR_full       241 TGGCTGGTTGAGGAAGTTAACTGGGTGTCAATCTGTGATTGCTGCCGCCAGTGGAGCCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9026R-3.in silico     241 TGGCTGGTTGAGGAAGTTAACTGGGTGTCAATCTGTGATTGCTGCCGCCAGTGGAGCCAA 300


9026R-3.IR_full       301 GGCGGATCGTCACCTGAATGAAGGGGATCGCATAGATTTCGGCACCCATGTGATTGATGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9026R-3.in silico     301 GGCGGATCGTCACCTGAATGAAGGGGATCGCATAGATTTCGGCACCCATGTGATTGATGC 360


9026R-3.IR_full       361 TCTGGCCACTCCGGGACACACAAATGGCTGCATGACCTATGTGATCAAGGATCAGGGTTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9026R-3.in silico     361 TCTGGCCACTCCGGGACACACAAATGGCTGCATGACCTATGTGATCAAGGATCAGGGTTG 420


9026R-3.IR_full       421 TGTCTTTACCGGAGATACTCTCCTGATACGAGGCTGTGGACGCACCGATTTCCAGGAAGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9026R-3.in silico     421 TGTCTTTACCGGAGATACTCTCCTGATACGAGGCTGTGGACGCACCGATTTCCAGGAAGG 480


9026R-3.IR_full       481 CTGCCCACCGTAATCTCTACG 501
                          ||||||| |||||||||||||
9026R-3.in silico     481 CTGCCCA-CGTAATCTCTACG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165830.1  CG30022-RA (CG30022), mRNA 
0.2   16  12  NM_001015327.1  CG40100-PA.3 (CG40100), mRNA 
0   NM_057830.3  CG9433-RB, transcript variant B (Xpd), mRNA 
0   NM_166429.1  CG9433-RA, transcript variant A (Xpd), mRNA 
0   NM_168479.1  CG5946-RA, transcript variant A (CG5946), mRNA 
0   NM_140255.2  CG5946-RB, transcript variant B (CG5946), mRNA 
0   NM_001043135.1  CG5946-RD, transcript variant D (CG5946), mRNA 
0   NM_001043136.1  CG5946-RC, transcript variant C (CG5946), mRNA 
0   NM_079059.2  CG5519-RA (Gbp), mRNA 
0   10  NM_167543.1  CG32574-RA (CG32574), mRNA 
0   NM_140053.2  CG3967-RC, transcript variant C (CG3967), mRNA 
0   NM_170630.1  CG3967-RD, transcript variant D (CG3967), mRNA 
0   NM_170631.1  CG3967-RE, transcript variant E (CG3967), mRNA 
0   NM_140052.1  CG3967-RA, transcript variant A (CG3967), mRNA 
0   NM_170632.1  CG3967-RB, transcript variant B (CG3967), mRNA 
0   NM_169569.1  CG31533-RA (CG31533), mRNA 
0   NM_164553.1  CG2818-RB, transcript variant B (CG2818), mRNA 
0   NM_134960.2  CG2818-RA, transcript variant A (CG2818), mRNA 
0   NM_166976.1  CG32791-RA (CG32791), mRNA 
0   NM_142715.2  CG7956-RA, transcript variant A (CG7956), mRNA 
0   NM_001014644.2  CG7956-RB, transcript variant B (CG7956), mRNA 
0   NM_001043275.1  CG7956-RC, transcript variant C (CG7956), mRNA 
0   NM_135780.1  CG15479-RA (CG15479), mRNA 
0   NM_132493.2  CG11715-RA, transcript variant A (Cyp4g15), mRNA 
0   NM_167287.1  CG11715-RB, transcript variant B (Cyp4g15), mRNA 
0   NM_132062.1  CG5921-RB, transcript variant B (CG5921), mRNA 
0   NM_167058.1  CG5921-RA, transcript variant A (CG5921), mRNA 
0   NM_133023.2  CG7846-RA (CG7846), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_142931.3  CG10192-RA (CG10192), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.