National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9026R-2 
 Symbol CG30022  Full Name CG30022 
 CG No CG30022  Old CG No CG9026 
 Synonyms CG9026, BcDNA:RE56416, CG30022 
 Accession No (Link to NCBI) NM_165830.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     1   TGGAACCATGAGCCTGCCGGAGCGCCAGCCCTTTTCTCCAGACTTCTTCTTCCGTCAACT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTTTGATGGAGAAAGCAGCACCTATAGCTACCTTCTGGCCGATCTAAAGAATGGTCAGGC 120

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGTAATCATTGATCCTGTTTTGGAGCAGGCGAAACGAGATGCCCAGCTGGTCAAGGATCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGGCTTCGAGTTGAAGTATGCCATCAACACACACATGCATGCGGATCACATAACGGGCAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGGCTGGTTGAGGAAGTTAACTGGGTGTCAATCTGTGATTGCTGCCGCCAGTGGAGCCAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCGGATCGTCACCTGAATGAAGGGGATCGCATAGATTTCGGCACCCATGTGATTGATGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCTGGCCACTCCGGGACACACAAATGGCTGCATGACCTATGTGATCAAGGATCAGGGTTG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTCTTTACCGGAGATACTCTCCTGATACGAGGCTGTGGACGCACCGATTTCCAGGAAGG 480

9026R-2.IR_full       481 CTGCCCACCGTAATCTCTACG 501
                          ||||||| ||||||||||||| silico     481 CTGCCCA-CGTAATCTCTACG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165830.1  CG30022-RA (CG30022), mRNA 
0.2   16  12  NM_001015327.1  CG40100-PA.3 (CG40100), mRNA 
0   NM_057830.3  CG9433-RB, transcript variant B (Xpd), mRNA 
0   NM_166429.1  CG9433-RA, transcript variant A (Xpd), mRNA 
0   NM_168479.1  CG5946-RA, transcript variant A (CG5946), mRNA 
0   NM_140255.2  CG5946-RB, transcript variant B (CG5946), mRNA 
0   NM_001043135.1  CG5946-RD, transcript variant D (CG5946), mRNA 
0   NM_001043136.1  CG5946-RC, transcript variant C (CG5946), mRNA 
0   NM_079059.2  CG5519-RA (Gbp), mRNA 
0   10  NM_167543.1  CG32574-RA (CG32574), mRNA 
0   NM_140053.2  CG3967-RC, transcript variant C (CG3967), mRNA 
0   NM_170630.1  CG3967-RD, transcript variant D (CG3967), mRNA 
0   NM_170631.1  CG3967-RE, transcript variant E (CG3967), mRNA 
0   NM_140052.1  CG3967-RA, transcript variant A (CG3967), mRNA 
0   NM_170632.1  CG3967-RB, transcript variant B (CG3967), mRNA 
0   NM_169569.1  CG31533-RA (CG31533), mRNA 
0   NM_164553.1  CG2818-RB, transcript variant B (CG2818), mRNA 
0   NM_134960.2  CG2818-RA, transcript variant A (CG2818), mRNA 
0   NM_166976.1  CG32791-RA (CG32791), mRNA 
0   NM_142715.2  CG7956-RA, transcript variant A (CG7956), mRNA 
0   NM_001014644.2  CG7956-RB, transcript variant B (CG7956), mRNA 
0   NM_001043275.1  CG7956-RC, transcript variant C (CG7956), mRNA 
0   NM_135780.1  CG15479-RA (CG15479), mRNA 
0   NM_132493.2  CG11715-RA, transcript variant A (Cyp4g15), mRNA 
0   NM_167287.1  CG11715-RB, transcript variant B (Cyp4g15), mRNA 
0   NM_132062.1  CG5921-RB, transcript variant B (CG5921), mRNA 
0   NM_167058.1  CG5921-RA, transcript variant A (CG5921), mRNA 
0   NM_133023.2  CG7846-RA (CG7846), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_142931.3  CG10192-RA (CG10192), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.