National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8976R-2 
 Symbol CG33145  Full Name CG33145 
 CG No CG33145  Old CG No CG8976 
 Synonyms CG8976, CG33145 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCCTCTTGGCAGCGGAATA 
 Primer Seq. 3'
aatctagaggtaccGCGGCAGGTAGTGACCCTTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8976R-2.IR full       1   GCTCCCTCTTGGCAGCGGAATATTCCTCCAGCTCGGGAGCAGCTGCTTCCGGATCCGAGG 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-2.in silico     1   -CTCCCTCTTGGCAGCGGAATATTCCTCCAGCTCGGGAGCAGCTGCTTCCGGATCCGAGG 60


8976R-2.IR full       61  ACGAGACGGTCACCACCAGTGGAGCGCTACGCAGCAAAGCAAAGCTGAGGAAGCGGCAGC 120
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
8976R-2.in silico     61  ACGAGACGGTCACCACTAGTGGAGCGCTACGCAGCAAAGCAAAGCTGAGGAAGCGGCAGC 120


8976R-2.IR full       121 TAAGAAATCGCATGCCGCTTCCCAGGATGTTAAGACGCCTTGGCTGCTACACGCTGAGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-2.in silico     121 TAAGAAATCGCATGCCGCTTCCCAGGATGTTAAGACGCCTTGGCTGCTACACGCTGAGCG 180


8976R-2.IR full       181 CCTTCCTAATCTGTGGGCTGCTCCTCGTCTACCTGCCGCTCGTCTACTTGGATGTACACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-2.in silico     181 CCTTCCTAATCTGTGGGCTGCTCCTCGTCTACCTGCCGCTCGTCTACTTGGATGTACACA 240


8976R-2.IR full       241 AGCGTAGTGCTGGTCTGCCGGATTGGACGTCAGAGACCTCCCGCAGCATAGCTGACTACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-2.in silico     241 AGCGTAGTGCTGGTCTGCCGGATTGGACGTCAGAGACCTCCCGCAGCATAGCTGACTACC 300


8976R-2.IR full       301 TGGATATCGGGCTCAGTTCTGGCGTCATTGTTCCCAAGGACTTTTGCCGGAATAAGACCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-2.in silico     301 TGGATATCGGGCTCAGTTCTGGCGTCATTGTTCCCAAGGACTTTTGCCGGAATAAGACCT 360


8976R-2.IR full       361 TCCTGGTAATCGCCGTATGCACCGGCGTGGACAACTTCATTCAGCGACAGACCATCCGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
8976R-2.in silico     361 TCCTGGTAATCGCCGTATGCACCGGCGTGGACAACTTCATTCAGCGACATACCATCCGTG 420


8976R-2.IR full       421 AGACCTGGGGCAATACCCCCGAGTTCAACTACCCAGCGTTTGGAAAGCTCCATGGTCATC 480
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8976R-2.in silico     421 AGACCTGGGGCAATACCACCGAGTTCAACTACCCAGCGTTTGGAAAGCTCCATGGTCATC 480


8976R-2.IR full       481 TCAAGGGTCACTACCTGCCGC 501
                          |||||||||||||||||||||
8976R-2.in silico     481 TCAAGGGTCACTACCTGCCGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_176148.1  CG33145-RB, transcript variant B (CG33145), mRNA 
100  482  NM_176149.1  CG33145-RA, transcript variant A (CG33145), mRNA 
NM_140519.2  CG7739-RA (CG7739), mRNA 
NM_141081.1  CG11307-RA, transcript variant A (CG11307), mRNA 
NM_168928.1  CG11307-RB, transcript variant B (CG11307), mRNA 
NM_079131.2  Exu-associated protein CG3594-RA (Eap), mRNA 
NM_080370.3  lightoid CG8024-RB, transcript variant B (ltd), mRNA 
NM_134870.1  CG15400-RA (CG15400), mRNA 
NM_058124.2  Sulfonylurea receptor CG5772-RA (Sur), mRNA 
NM_142800.1  octopamine receptor 2 CG6919-RA, transcript variant A (oa2), mRNA 
NM_001038975.1  octopamine receptor 2 CG6919-RB, transcript variant B (oa2), mRNA 
NM_167841.1  CG32341-RA (CG32341), mRNA 
19  NM_001032051.1  Muscle-specific protein 300 CG33715-RD, transcript variant D (Msp-300), mRNA 
18  NM_137050.1  CG6209-RA (CG6209), mRNA 
NM_176581.2  CG33204-RA (CG33204), mRNA 
NM_142370.1  CG5873-RA (CG5873), mRNA 
NM_167301.1  CG2446-RE, transcript variant E (CG2446), mRNA 
NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 
NM_167299.1  CG2446-RB, transcript variant B (CG2446), mRNA 
NM_132513.4  CG2446-RC, transcript variant C (CG2446), mRNA 
11  NM_136864.2  CG13185-RA (CG13185), mRNA 
NM_167956.1  daughter of sevenless CG1044-RB, transcript variant B (dos), mRNA 
NM_079166.2  daughter of sevenless CG1044-RA, transcript variant A (dos), mRNA 
NM_135755.1  CG9932-RA (CG9932), mRNA 
NM_140611.2  CG13043-RA (CG13043), mRNA 
NM_140612.1  CG13063-RA (CG13063), mRNA 
NM_135799.2  CG9305-RA (CG9305), mRNA 
NM_139458.2  CG1317-RB (CG1317), mRNA 
NM_141447.2  CG14609-RA (CG14609), mRNA 
13  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.