National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8976R-1 
 Symbol CG33145  Full Name CG33145 
 CG No CG33145  Old CG No CG8976 
 Synonyms CG8976, CG33145 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCCTCTTGGCAGCGGAATA 
 Primer Seq. 3'
aatctagaggtaccGCGGCAGGTAGTGACCCTTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTCCCTCTT GGCAGCGGAA TATTCCTCCA GCTCGGGAGC AGCTGCTTCC GGATCCGAGG 
0061 ACGAGACGGT CACCACCAGT GGAGCGCTAC GCAGCAAAGC AAAGCTGAGG AAGCGGCAGC 
0121 TAAGAAATCG CATGCCGCTT CCCAGGATGT TAAGACGCCT TGGCTGCTAC ACGCTGAGCG 
0181 CCTTCCTAAT CTGTGGGCTG CTCCTCGTCT ACCTGCCGCT CGTCTACTTG GATGTACACA 
0241 AGCGTAGTGC TGGTCTGCCG GATTGGACGT CAGAGACCTC CCGCAGCATA GCTGACTACC 
0301 TGGATATCGG GCTCAGTTCT GGCGTCATTG TTCCCAAGGA CTTTTGCCGG AATAAGACCT 
0361 TCCTGGTAAT CGCCGTATGC ACCGGCGTGG ACAACTTCAT TCAGCGACAG ACCATCCGTG 
0421 AGACCTGGGG CAATACCCCC GAGTTCAACT ACCCAGCGTT TGGAAAGCTC CATGGTCATC 
0481 TCAAGGGTCA CTACCTGCCG C 
 in silico PCR Fragment
0001 ctccctcttg gcagcggaat attcctccag ctcgggagca gctgcttccg gatccgagga 
0061 cgagacggtc accactagtg gagcgctacg cagcaaagca aagctgagga agcggcagct 
0121 aagaaatcgc atgccgcttc ccaggatgtt aagacgcctt ggctgctaca cgctgagcgc 
0181 cttcctaatc tgtgggctgc tcctcgtcta cctgccgctc gtctacttgg atgtacacaa 
0241 gcgtagtgct ggtctgccgg attggacgtc agagacctcc cgcagcatag ctgactacct 
0301 ggatatcggg ctcagttctg gcgtcattgt tcccaaggac ttttgccgga ataagacctt 
0361 cctggtaatc gccgtatgca ccggcgtgga caacttcatt cagcgacata ccatccgtga 
0421 gacctggggc aataccaccg agttcaacta cccagcgttt ggaaagctcc atggtcatct 
0481 caagggtcac tacctgccgc  
 Assemble Data

8976R-1.IR full       1   GCTCCCTCTTGGCAGCGGAATATTCCTCCAGCTCGGGAGCAGCTGCTTCCGGATCCGAGG 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-1.in silico     1   -CTCCCTCTTGGCAGCGGAATATTCCTCCAGCTCGGGAGCAGCTGCTTCCGGATCCGAGG 60


8976R-1.IR full       61  ACGAGACGGTCACCACCAGTGGAGCGCTACGCAGCAAAGCAAAGCTGAGGAAGCGGCAGC 120
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
8976R-1.in silico     61  ACGAGACGGTCACCACTAGTGGAGCGCTACGCAGCAAAGCAAAGCTGAGGAAGCGGCAGC 120


8976R-1.IR full       121 TAAGAAATCGCATGCCGCTTCCCAGGATGTTAAGACGCCTTGGCTGCTACACGCTGAGCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-1.in silico     121 TAAGAAATCGCATGCCGCTTCCCAGGATGTTAAGACGCCTTGGCTGCTACACGCTGAGCG 180


8976R-1.IR full       181 CCTTCCTAATCTGTGGGCTGCTCCTCGTCTACCTGCCGCTCGTCTACTTGGATGTACACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-1.in silico     181 CCTTCCTAATCTGTGGGCTGCTCCTCGTCTACCTGCCGCTCGTCTACTTGGATGTACACA 240


8976R-1.IR full       241 AGCGTAGTGCTGGTCTGCCGGATTGGACGTCAGAGACCTCCCGCAGCATAGCTGACTACC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-1.in silico     241 AGCGTAGTGCTGGTCTGCCGGATTGGACGTCAGAGACCTCCCGCAGCATAGCTGACTACC 300


8976R-1.IR full       301 TGGATATCGGGCTCAGTTCTGGCGTCATTGTTCCCAAGGACTTTTGCCGGAATAAGACCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8976R-1.in silico     301 TGGATATCGGGCTCAGTTCTGGCGTCATTGTTCCCAAGGACTTTTGCCGGAATAAGACCT 360


8976R-1.IR full       361 TCCTGGTAATCGCCGTATGCACCGGCGTGGACAACTTCATTCAGCGACAGACCATCCGTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
8976R-1.in silico     361 TCCTGGTAATCGCCGTATGCACCGGCGTGGACAACTTCATTCAGCGACATACCATCCGTG 420


8976R-1.IR full       421 AGACCTGGGGCAATACCCCCGAGTTCAACTACCCAGCGTTTGGAAAGCTCCATGGTCATC 480
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8976R-1.in silico     421 AGACCTGGGGCAATACCACCGAGTTCAACTACCCAGCGTTTGGAAAGCTCCATGGTCATC 480


8976R-1.IR full       481 TCAAGGGTCACTACCTGCCGC 501
                          |||||||||||||||||||||
8976R-1.in silico     481 TCAAGGGTCACTACCTGCCGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_176148.1  CG33145-RB, transcript variant B (CG33145), mRNA 
100  482  NM_176149.1  CG33145-RA, transcript variant A (CG33145), mRNA 
NM_140519.2  CG7739-RA (CG7739), mRNA 
NM_141081.1  CG11307-RA, transcript variant A (CG11307), mRNA 
NM_168928.1  CG11307-RB, transcript variant B (CG11307), mRNA 
NM_079131.2  Exu-associated protein CG3594-RA (Eap), mRNA 
NM_080370.3  lightoid CG8024-RB, transcript variant B (ltd), mRNA 
NM_134870.1  CG15400-RA (CG15400), mRNA 
NM_058124.2  Sulfonylurea receptor CG5772-RA (Sur), mRNA 
NM_142800.1  octopamine receptor 2 CG6919-RA, transcript variant A (oa2), mRNA 
NM_001038975.1  octopamine receptor 2 CG6919-RB, transcript variant B (oa2), mRNA 
NM_167841.1  CG32341-RA (CG32341), mRNA 
19  NM_001032051.1  Muscle-specific protein 300 CG33715-RD, transcript variant D (Msp-300), mRNA 
18  NM_137050.1  CG6209-RA (CG6209), mRNA 
NM_176581.2  CG33204-RA (CG33204), mRNA 
NM_142370.1  CG5873-RA (CG5873), mRNA 
NM_167301.1  CG2446-RE, transcript variant E (CG2446), mRNA 
NM_167300.1  CG2446-RD, transcript variant D (CG2446), mRNA 
NM_167299.1  CG2446-RB, transcript variant B (CG2446), mRNA 
NM_132513.4  CG2446-RC, transcript variant C (CG2446), mRNA 
11  NM_136864.2  CG13185-RA (CG13185), mRNA 
NM_167956.1  daughter of sevenless CG1044-RB, transcript variant B (dos), mRNA 
NM_079166.2  daughter of sevenless CG1044-RA, transcript variant A (dos), mRNA 
NM_135755.1  CG9932-RA (CG9932), mRNA 
NM_140611.2  CG13043-RA (CG13043), mRNA 
NM_140612.1  CG13063-RA (CG13063), mRNA 
NM_135799.2  CG9305-RA (CG9305), mRNA 
NM_139458.2  CG1317-RB (CG1317), mRNA 
NM_141447.2  CG14609-RA (CG14609), mRNA 
13  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.