National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8952R-3 
 Symbol CG8952  Full Name CG8952 
 CG No CG8952  Old CG No CG8952 
 Synonyms SP52, CG8952 
 Accession No (Link to NCBI) NM_132844.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCGCTGAATAGCGAGCGA 
 Primer Seq. 3'
aatctagaggtaccCCGTATAACCGAATCCAGCGA 
 Predicted Fragment Size
502 
 IR fragment full Seq
0001 ATGGCGCTGA ATAGCgAGCG CATCCTTGAT GCTAGTCCTA TTGGCTGCCA TCTCCGTTGT 
0061 TGGCCAACCC TTTGATCCTG CCAACAGTTC ACCGATAAAA ATAGATAATC GCATAGTGTC 
0121 CGGTANGCGA TGCGANAATT GGGCCAGTTT CCCTGGCAGG TCATACTGAA GAGAGATGCC 
0181 TGGGATGATC TACTTTGCGG AGGATCGATC ATATCGGACA CCTGGGTGCT CACGGCGGCC 
0241 CATTGTACAA ATGGCCTGAG CTCCATCTTC CTGATGTTCG GCACTGTGGA TCTGTTTAAC 
0301 GCGAATGCCC TGAACATGAC GTCCAACAAT ATCATAATCC ATCCGGACTA CAATGACAAA 
0361 TTGAATAACG ATGTCTCGCT GATCCAACTG CCAGAACCAC TGACATTCTC GGCCAACATT 
0421 CAGGCCATAC AACTGGTCGG CCAGTACGGG GACTCGATCG ATTATGTGGG CAGCGTGGCC 
0481 ACAATCGCTG GATTCGGTTA TACgg 
 in silico PCR Fragment
0001 ATGGCGCTGA ATAGCGAGCG -ATCCTTGAT GCTAGTCCTA TTGGCTGCCA TCTCCGTTGT 
0061 TGGCCAACCC TTTGATCCTG CCAACAGTTC ACCGATAAAA ATAGATAATC GCATAGTGTC 
0121 CGGTA-GCGA TGCGA-AATT GGGCCAGTTT CCCTGGCAGG TCATACTGAA GAGAGATGCC 
0181 TGGGATGATC TACTTTGCGG AGGATCGATC ATATCGGACA CCTGGGTGCT CACGGCGGCC 
0241 CATTGTACAA ATGGCCTGAG CTCCATCTTC CTGATGTTCG GCACTGTGGA TCTGTTTAAC 
0301 GCGAATGCCC TGAACATGAC GTCCAACAAT ATCATAATCC ATCCGGACTA CAATGACAAA 
0361 TTGAATAACG ATGTCTCGCT GATCCAACTG CCAGAACCAC TGACATTCTC GGCCAACATT 
0421 CAGGCCATAC AACTGGTCGG CCAGTACGGG GACTCGATCG ATTATGTGGG CAGCGTGGCC 
0481 ACAATCGCTG GATTCGGTTA TACGG 
 Assemble Data

8952R-3.IR_full       1   ATGGCGCTGAATAGCGAGCGCATCCTTGATGCTAGTCCTATTGGCTGCCATCTCCGTTGT 60
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     1   ATGGCGCTGAATAGCGAGCG-ATCCTTGATGCTAGTCCTATTGGCTGCCATCTCCGTTGT 60


8952R-3.IR_full       61  TGGCCAACCCTTTGATCCTGCCAACAGTTCACCGATAAAAATAGATAATCGCATAGTGTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     61  TGGCCAACCCTTTGATCCTGCCAACAGTTCACCGATAAAAATAGATAATCGCATAGTGTC 120


8952R-3.IR_full       121 CGGTANGCGATGCGANAATTGGGCCAGTTTCCCTGGCAGGTCATACTGAAGAGAGATGCC 180
                          ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     121 CGGTA-GCGATGCGA-AATTGGGCCAGTTTCCCTGGCAGGTCATACTGAAGAGAGATGCC 180


8952R-3.IR_full       181 TGGGATGATCTACTTTGCGGAGGATCGATCATATCGGACACCTGGGTGCTCACGGCGGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     181 TGGGATGATCTACTTTGCGGAGGATCGATCATATCGGACACCTGGGTGCTCACGGCGGCC 240


8952R-3.IR_full       241 CATTGTACAAATGGCCTGAGCTCCATCTTCCTGATGTTCGGCACTGTGGATCTGTTTAAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     241 CATTGTACAAATGGCCTGAGCTCCATCTTCCTGATGTTCGGCACTGTGGATCTGTTTAAC 300


8952R-3.IR_full       301 GCGAATGCCCTGAACATGACGTCCAACAATATCATAATCCATCCGGACTACAATGACAAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     301 GCGAATGCCCTGAACATGACGTCCAACAATATCATAATCCATCCGGACTACAATGACAAA 360


8952R-3.IR_full       361 TTGAATAACGATGTCTCGCTGATCCAACTGCCAGAACCACTGACATTCTCGGCCAACATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     361 TTGAATAACGATGTCTCGCTGATCCAACTGCCAGAACCACTGACATTCTCGGCCAACATT 420


8952R-3.IR_full       421 CAGGCCATACAACTGGTCGGCCAGTACGGGGACTCGATCGATTATGTGGGCAGCGTGGCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8952R-3.in silico     421 CAGGCCATACAACTGGTCGGCCAGTACGGGGACTCGATCGATTATGTGGGCAGCGTGGCC 480


8952R-3.IR_full       481 ACAATCGCTGGATTCGGTTATACGG 505
                          |||||||||||||||||||||||||
8952R-3.in silico     481 ACAATCGCTGGATTCGGTTATACGG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   484  NM_132844.2  CG8952-RA (CG8952), mRNA 
0.2   NM_166871.1  CG14624-RA (CG14624), mRNA 
0   NM_139605.1  CG1299-RA (CG1299), mRNA 
0   NM_142305.1  CG14892-RA (CG14892), mRNA 
0   NM_130583.2  CG3795-RA (CG3795), mRNA 
0   NM_164523.1  CG17221-RB, transcript variant B (CG17221), mRNA 
0   NM_134902.1  CG17221-RA, transcript variant A (CG17221), mRNA 
0   12  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   NM_133094.1  CG12609-RA, transcript variant A (CG12609), mRNA 
0   NM_167629.1  CG12609-RB, transcript variant B (CG12609), mRNA 
0   NM_079924.2  CG18780-RA (MED20), mRNA 
0   NM_136591.3  CG8213-RA (CG8213), mRNA 
0   NM_165049.1  CG31814-RA (CG31814), mRNA 
0   NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_143422.1  CG11898-RA (CG11898), mRNA 
0   NM_079878.3  CG2125-RA (ci), mRNA 
0   NM_079709.2  CG7895-RA (tin), mRNA 
0   NM_165245.2  CG31746-RA (CG31746), mRNA 
0   NM_136942.2  CG8545-RA (CG8545), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_164317.2  CG1107-RA, transcript variant A (auxillin), mRNA 
0   NM_141181.2  CG1107-RB, transcript variant B (auxillin), mRNA 
0   NM_136592.1  CG11824-RA (CG11824), mRNA 
0   NM_143527.2  CG9733-RA (CG9733), mRNA 
0   NM_140327.1  CG10522-RA (sti), mRNA 
0   NM_166623.1  CG4051-RA (egl), mRNA 
0   NM_001043313.1  CG34155-RA (CG34155), mRNA 
0   NM_136069.2  CG10600-RA (CG10600), mRNA 
0   NM_169750.2  CG31266-RA (CG31266), mRNA 
0   NM_141554.2  CG8032-RA (CG8032), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.