National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8896R-2 
 Symbol 18w  Full Name 18 wheeler 
 CG No CG8896  Old CG No CG8896 
 Synonyms toll, 18W, CT25100, tlr, l(2)00053, CG8896, 18w 
 Accession No (Link to NCBI) NM_057466.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCCTGCCTGTTGCTTCTTG 
 Primer Seq. 3'
aatctagaggtaccCCGGTTCTGGGTGAGATTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGCCTGCCT GTTGCTTCTT GTGGCTGATG CGCATGCGCA GCAGCAGTGC AACTGGCAGT 
0061 ACGGCCTCAC CACCATGGAC ATCCGGTGCA GTGTCCGCGC TCTGGAGTCC GGCACCGGAA 
0121 CGCCACTTGA CCTCCAGGTG GCGGAGGCGG CCGGCCGCCT GGATCTGCAG TGCAGCCAGG 
0181 AGCTCCTGCA TGCCAGTGAA CTGGCACCGG GACTCTTCCG GCAACTGCAG AAGCTCTCGG 
0241 AGCTGCGAAT CGATGCCTGC AAACTGCAGC GAGTGCCTCC AAATGCATTT GAGGGTCTGA 
0301 TGTCGCTCAA GCGACTCACC CTGGAGTCAC ACAACGCGGT CTGGGGTCCG GGAAAGACCC 
0361 TGGAGTTGCA CGGCCAGTCG TTCCAGGGAC TGAAGGAGCT GTCCGAGCTG CACTTGGGCG 
0421 ACAACAATAT CCGTCAGTTG CCCGAGGGCG TCTGGTGCTC CATGCCCAGC CTGCAACTGC 
0481 TCAATCTCAC CCAGAACCGG  
 in silico PCR Fragment
0001 CTGCCTGCCT GTTGCTTCTT GTGGCTGATG CGCATGCGCA GCAGCAGTGC AACTGGCAGT 
0061 ACGGCCTCAC CACCATGGAC ATCCGGTGCA GTGTCCGCGC TCTGGAGTCC GGCACCGGAA 
0121 CGCCACTTGA CCTCCAGGTG GCGGAGGCGG CCGGCCGCCT GGATCTGCAG TGCAGCCAGG 
0181 AGCTCCTGCA TGCCAGTGAA CTGGCACCGG GACTCTTCCG GCAACTGCAG AAGCTCTCGG 
0241 AGCTGCGAAT CGATGCCTGC AAACTGCAGC GAGTGCCTCC AAATGCATTT GAGGGTCTGA 
0301 TGTCGCTCAA GCGACTCACC CTGGAGTCAC ACAACGCGGT CTGGGGTCCG GGAAAGACCC 
0361 TGGAGTTGCA CGGCCAGTCG TTCCAGGGAC TGAAGGAGCT GTCCGAGCTG CACTTGGGCG 
0421 ACAACAATAT CCGTCAGTTG CCCGAGGGCG TCTGGTGCTC CATGCCCAGC CTGCAACTGC 
0481 TCAATCTCAC CCAGAACCGG  
 Assemble Data

8896R-2.IR_full       1   CTGCCTGCCTGTTGCTTCTTGTGGCTGATGCGCATGCGCAGCAGCAGTGCAACTGGCAGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     1   CTGCCTGCCTGTTGCTTCTTGTGGCTGATGCGCATGCGCAGCAGCAGTGCAACTGGCAGT 60


8896R-2.IR_full       61  ACGGCCTCACCACCATGGACATCCGGTGCAGTGTCCGCGCTCTGGAGTCCGGCACCGGAA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     61  ACGGCCTCACCACCATGGACATCCGGTGCAGTGTCCGCGCTCTGGAGTCCGGCACCGGAA 120


8896R-2.IR_full       121 CGCCACTTGACCTCCAGGTGGCGGAGGCGGCCGGCCGCCTGGATCTGCAGTGCAGCCAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     121 CGCCACTTGACCTCCAGGTGGCGGAGGCGGCCGGCCGCCTGGATCTGCAGTGCAGCCAGG 180


8896R-2.IR_full       181 AGCTCCTGCATGCCAGTGAACTGGCACCGGGACTCTTCCGGCAACTGCAGAAGCTCTCGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     181 AGCTCCTGCATGCCAGTGAACTGGCACCGGGACTCTTCCGGCAACTGCAGAAGCTCTCGG 240


8896R-2.IR_full       241 AGCTGCGAATCGATGCCTGCAAACTGCAGCGAGTGCCTCCAAATGCATTTGAGGGTCTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     241 AGCTGCGAATCGATGCCTGCAAACTGCAGCGAGTGCCTCCAAATGCATTTGAGGGTCTGA 300


8896R-2.IR_full       301 TGTCGCTCAAGCGACTCACCCTGGAGTCACACAACGCGGTCTGGGGTCCGGGAAAGACCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     301 TGTCGCTCAAGCGACTCACCCTGGAGTCACACAACGCGGTCTGGGGTCCGGGAAAGACCC 360


8896R-2.IR_full       361 TGGAGTTGCACGGCCAGTCGTTCCAGGGACTGAAGGAGCTGTCCGAGCTGCACTTGGGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     361 TGGAGTTGCACGGCCAGTCGTTCCAGGGACTGAAGGAGCTGTCCGAGCTGCACTTGGGCG 420


8896R-2.IR_full       421 ACAACAATATCCGTCAGTTGCCCGAGGGCGTCTGGTGCTCCATGCCCAGCCTGCAACTGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8896R-2.in silico     421 ACAACAATATCCGTCAGTTGCCCGAGGGCGTCTGGTGCTCCATGCCCAGCCTGCAACTGC 480


8896R-2.IR_full       481 TCAATCTCACCCAGAACCGG 500
                          ||||||||||||||||||||
8896R-2.in silico     481 TCAATCTCACCCAGAACCGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  18  NM_057466.2  CG8896-RA (18w), mRNA 
0.41   NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0.41   NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0.2   NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
0   NM_079073.1  CG8595-RA (Toll-7), mRNA 
0   NM_139857.2  CG32380-RA, transcript variant A (SMSr), mRNA 
0   NM_168212.1  CG32380-RB, transcript variant B (SMSr), mRNA 
0   NM_079113.2  CG4012-RA (gek), mRNA 
0   NM_137195.2  CG8180-RA (CG8180), mRNA 
0   11  NM_078645.2  CG4252-RA (mei-41), mRNA 
0   NM_143182.2  CG5913-RA (CG5913), mRNA 
0   NM_164827.1  CG17834-RC, transcript variant C (CG17834), mRNA 
0   NM_135398.2  CG17834-RA, transcript variant A (CG17834), mRNA 
0   NM_167888.1  CG12090-RC, transcript variant C (CG12090), mRNA 
0   NM_167889.1  CG12090-RA, transcript variant A (CG12090), mRNA 
0   NM_139361.1  CG12090-RB, transcript variant B (CG12090), mRNA 
0   NM_132674.2  CG9938-RA (CG9938), mRNA 
0   NM_141181.2  CG1107-RB, transcript variant B (auxillin), mRNA 
0   NM_164317.2  CG1107-RA, transcript variant A (auxillin), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_057614.2  CG4926-RA (Ror), mRNA 
0   NM_137135.2  CG12860-RA (CG12860), mRNA 
0   NM_001038982.1  CG33970-RA, transcript variant A (CG33970), mRNA 
0   NM_001038981.1  CG33970-RB, transcript variant B (CG33970), mRNA 
0   NM_078760.2  CG6992-RI (GluRIIA), mRNA 
0   NM_168228.1  CG32375-RA (CG32375), mRNA 
0   NM_166076.1  CG12424-RB, transcript variant B (CG12424), mRNA 
0   NM_137165.1  CG12424-RA, transcript variant A (CG12424), mRNA 
0   NM_166077.1  CG12424-RC, transcript variant C (CG12424), mRNA 
0   NM_168238.1  CG17888-RH, transcript variant H (Pdp1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.