National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8871R-1 
 Symbol Jon25Biii  Full Name Jonah 25Biii 
 CG No CG8871  Old CG No CG8871 
 Synonyms CG8871, 25B, SP177, Jon25B, Jon25Biii 
 Accession No (Link to NCBI) NM_135037.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCCAAGGCCACCAAGATTGA 
 Primer Seq. 3'
aatctagaggtaccAGATGACGTTGTCGCCAACGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCCAAGGcC ACCAAGATTG AGGGTCGTAT CACCAACGNA TACGCCGCCC CCGAGGNTAA 
0061 GGCTCCCTAC ACTGTGGGTC TTGGCTTCAG NGGAGGcTGG TGGTGCGGTG GCTCCATCAT 
0121 CGCCCACGAC TGGGTCCTGA CTGCCGAGCN CTGCATCGGA GATgcCGCNT TCCGTGATCG 
0181 TTTACTTCGG TGCCACCTGG cGCACCAACG GCCCAGTTCA CCCACACCGT TGGCAACGGC 
0241 AACTTCATCA AGCATTCCAA CGCTGATATC GCCCTGATCC GCATCCCCCA CGTCGACTTC 
0301 TGGCACATGG TGAACAAGGT GGAGCTCCCC AGCTACAACG ACCGTTACAA CAACTACAAC 
0361 GAATGGTGGG CCGTCGCTTG CGGATGGGGT GGCACCTACG ACGGCAGCCC ACTGCCCGAC 
0421 TGGCTGCAGT GCGTCGATCT CCAGATCGTC CACAACGAAG AGTGCGGCTG GACCTACGGC 
0481 AGCGTTGGCG ACAACGTCAT CT 
 in silico PCR Fragment
0001 GCCCAAGGCC ACCAAGATTG AGGGTCGTAT CACCAACGGA TACGCCGCCC CCGAGGGTAA 
0061 GGCTCCCTAC ACTGTGGGTC TTGGCTTCAG CGGAGGCTGG TGGTGCGGTG GCTCCATCAT 
0121 CGCCCACGAC TGGGTCCTGA CTGCCGAGCA CTGCATCGGA GATGCCGC-T TCCGTGATCG 
0181 TTTACTTCGG TGCCACCTGG CGCACCAAC- GCCCAGTTCA CCCACACCGT TGGCAACGGC 
0241 AACTTCATCA AGCATTCCAA CGCTGATATC GCCCTGATCC GCATCCCCCA CGTCGACTTC 
0301 TGGCACATGG TGAACAAGGT GGAGCTCCCC AGCTACAACG ACCGTTACAA CAACTACAAC 
0361 GAATGGTGGG CCGTCGCTTG CGGATGGGGT GGCACCTACG ACGGCAGCCC ACTGCCCGAC 
0421 TGGCTGCAGT GCGTCGATCT CCAGATCGTC CACAACGAAG AGTGCGGCTG GACCTACGGC 
0481 AGCGTTGGCG ACAACGTCAT CT 
 Assemble Data

8871R-1.IR_full       1   GCCCAAGGCCACCAAGATTGAGGGTCGTATCACCAACGNATACGCCGCCCCCGAGGNTAA 60
                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||
8871R-1.in silico     1   GCCCAAGGCCACCAAGATTGAGGGTCGTATCACCAACGGATACGCCGCCCCCGAGGGTAA 60


8871R-1.IR_full       61  GGCTCCCTACACTGTGGGTCTTGGCTTCAGNGGAGGCTGGTGGTGCGGTGGCTCCATCAT 120
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
8871R-1.in silico     61  GGCTCCCTACACTGTGGGTCTTGGCTTCAGCGGAGGCTGGTGGTGCGGTGGCTCCATCAT 120


8871R-1.IR_full       121 CGCCCACGACTGGGTCCTGACTGCCGAGCNCTGCATCGGAGATGCCGCNTTCCGTGATCG 180
                          ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||
8871R-1.in silico     121 CGCCCACGACTGGGTCCTGACTGCCGAGCACTGCATCGGAGATGCCGC-TTCCGTGATCG 180


8871R-1.IR_full       181 TTTACTTCGGTGCCACCTGGCGCACCAACGGCCCAGTTCACCCACACCGTTGGCAACGGC 240
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
8871R-1.in silico     181 TTTACTTCGGTGCCACCTGGCGCACCAAC-GCCCAGTTCACCCACACCGTTGGCAACGGC 240


8871R-1.IR_full       241 AACTTCATCAAGCATTCCAACGCTGATATCGCCCTGATCCGCATCCCCCACGTCGACTTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8871R-1.in silico     241 AACTTCATCAAGCATTCCAACGCTGATATCGCCCTGATCCGCATCCCCCACGTCGACTTC 300


8871R-1.IR_full       301 TGGCACATGGTGAACAAGGTGGAGCTCCCCAGCTACAACGACCGTTACAACAACTACAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8871R-1.in silico     301 TGGCACATGGTGAACAAGGTGGAGCTCCCCAGCTACAACGACCGTTACAACAACTACAAC 360


8871R-1.IR_full       361 GAATGGTGGGCCGTCGCTTGCGGATGGGGTGGCACCTACGACGGCAGCCCACTGCCCGAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8871R-1.in silico     361 GAATGGTGGGCCGTCGCTTGCGGATGGGGTGGCACCTACGACGGCAGCCCACTGCCCGAC 420


8871R-1.IR_full       421 TGGCTGCAGTGCGTCGATCTCCAGATCGTCCACAACGAAGAGTGCGGCTGGACCTACGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8871R-1.in silico     421 TGGCTGCAGTGCGTCGATCTCCAGATCGTCCACAACGAAGAGTGCGGCTGGACCTACGGC 480


8871R-1.IR_full       481 AGCGTTGGCGACAACGTCATCT 502
                          ||||||||||||||||||||||
8871R-1.in silico     481 AGCGTTGGCGACAACGTCATCT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
8.5   41  82  114  89  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
8.09   39  87  102  101  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
4.14   20  63  87  61  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
4.14   20  63  87  61  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
1.65   25  27  28  NM_140084.1  CG18180-RA (CG18180), mRNA 
1.45   20  NM_079220.1  CG6457-RA (yip7), mRNA 
1.03   55  41  62  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
1.03   41  63  54  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
1.03   39  51  85  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
1.03   39  51  83  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.41   16  32  65  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0.41   15  28  57  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0.41   12  30  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0   11  13  17  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0   10  19  18  NM_140083.1  CG18179-RA (CG18179), mRNA 
0   16  NM_079831.2  CG31039-RA (Jon99Ci), mRNA 
0   30  51  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0   NM_141908.1  CG17404-RA (CG17404), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_136501.1  CG11191-RA (CG11191), mRNA 
0   NM_165731.1  CG2264-RC, transcript variant C (CG2264), mRNA 
0   NM_165730.1  CG2264-RA, transcript variant A (CG2264), mRNA 
0   NM_136704.2  CG2264-RB, transcript variant B (CG2264), mRNA 
0   NM_165733.1  CG2264-RE, transcript variant E (CG2264), mRNA 
0   NM_165732.1  CG2264-RD, transcript variant D (CG2264), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.