National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8867R-2 
 Symbol Jon25Bi  Full Name Jonah 25Bi 
 CG No CG8867  Old CG No CG8867 
 Synonyms 25B, Ser4, SP137, CG8867, Jon25B, Jon25Bi 
 Accession No (Link to NCBI) NM_078753.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTGTCCAGCAGGTTCATCCCAAGGACCTGCCCAAGGACACCAAGATCAATGGCCGCATT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTGAACGGATATCCAGCCTACGAGGGCAAGGCTCCCTACACCGTGGGTCTGGGCTTCAGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCAACGGCGGCTGGTGGTGCGGTGGTTCTATCATCGCCCACGATTGGGTCCTGACTGCT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     181 GCTCACTGCACCAACGGCGCCTCCCAGGTGACCATCTACTACGGAGCCACCTGGCGCACC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AACGCCCAGTTCACCCACACCGTCGGCAGCGGCGACTTCATCCAGAACCACAACTGGCCC 300

                          |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     301 AACCAGAACGGCAACGACATCGCCTTGATCCGCACCCCCCACGT-GGACTTCTGGCACAT 360

                          || |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| silico     361 GG-TTAACAAGGT-GGAGCTGCCCAGCTTCAACGATCGCTACAACATGTACG-ACAACTA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTGGGCCGTCGCCTGCGGTTGGGGACTGACCACCGCCGGATCCCAGCCCGATTGGATGGA 480

8867R-2.IR_full       481 GTGCGTCGACCTGCAGATCATTAG 504
                          |||||||||||||||||||||||| silico     481 GTGCGTCGACCTGCAGATCATTAG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
100   482  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
8.71   42  81  28  37  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
6.63   32  62  39  51  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
4.14   20  71  88  64  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
1.03   29  69  57  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0.82   33  39  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0.41   25  18  35  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0.41   52  NM_140084.1  CG18180-RA (CG18180), mRNA 
0.2   37  54  65  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0.2   24  48  54  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0.2   23  19  16  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0.2   19  74  75  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.2   14  73  92  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.2   13  90  52  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.2   NM_143286.1  CG5896-RB, transcript variant B (CG5896), mRNA 
0.2   NM_170318.1  CG5896-RA, transcript variant A (CG5896), mRNA 
0   13  27  17  NM_079220.1  CG6457-RA (yip7), mRNA 
0   15  18  NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_140096.3  CG18177-RB, transcript variant B (CG18177), mRNA 
0   NM_206310.1  CG18177-RA, transcript variant A (CG18177), mRNA 
0   18  25  NM_139753.1  CG10477-RA (CG10477), mRNA 
0   15  22  NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
0   15  NM_140737.1  CG6298-RA (Jon74E), mRNA 
0   NM_080153.3  CG10261-RA, transcript variant A (aPKC), mRNA 
0   NM_001043076.1  CG10261-RC, transcript variant C (aPKC), mRNA 
0   NM_001043080.1  CG10261-RD, transcript variant D (aPKC), mRNA 
0   NM_001043078.1  CG10261-RE, transcript variant E (aPKC), mRNA 
0   NM_001043079.1  CG10261-RB, transcript variant B (aPKC), mRNA 
0   NM_001043077.1  CG10261-RF, transcript variant F (aPKC), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.