National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8867R-1 
 Symbol Jon25Bi  Full Name Jonah 25Bi 
 CG No CG8867  Old CG No CG8867 
 Synonyms 25B, Ser4, SP137, CG8867, Jon25B, Jon25Bi 
 Accession No (Link to NCBI) NM_078753.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTGTCCAGCAGGTTCATCCC 
 Primer Seq. 3'
aatctagaggtaccCTAATGATCTGCAGGTCGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTGTCCAGC AGGTTCATCC CAAGGACCTG CCCAAGGACA CCAAGATCAA TGGCCGCATT 
0061 GTGAACGGAT ATCCAGCCTA CGAGGGCAAG GCTCCCTACA CCGTGGGTCT GGGCTTCAGC 
0121 GGCAACGGCG GCTGGTGGTG CGGTGGTTCT ATCATCGCCC ACGATTGGGT CCTGACTGCT 
0181 GCTCACTGCA CCAACGGCGC CTCCCAGGTG ACCATCTACT ACGGAGCCAC CTAGCGCACC 
0241 AACGCCCAGT TCACCCACAC CGTCGGCAGC GGCGACTTCA TCCAGAACCA CAACTGGCCC 
0301 AACCAGAACG GCAACGACAT CGCCTTGATC CGCACCCCCC ACGTGGGACT TCTGGCACAT 
0361 GGNTTAACAA GGTGGGAGCT GCCCAGCTTC AACGATCGCT ACAACATGTA CGAACAACTA 
0421 TTGGGCCGTC GcCTGCGGTT GGGGACTGAC CACCGCCGGA TCCCAGCCCG ATTGGATGGA 
0481 GTGCGTCGAC CTGCAGATCA TTAG 
 in silico PCR Fragment
0001 ACTGTCCAGC AGGTTCATCC CAAGGACCTG CCCAAGGACA CCAAGATCAA TGGCCGCATT 
0061 GTGAACGGAT ATCCAGCCTA CGAGGGCAAG GCTCCCTACA CCGTGGGTCT GGGCTTCAGC 
0121 GGCAACGGCG GCTGGTGGTG CGGTGGTTCT ATCATCGCCC ACGATTGGGT CCTGACTGCT 
0181 GCTCACTGCA CCAACGGCGC CTCCCAGGTG ACCATCTACT ACGGAGCCAC CTGGCGCACC 
0241 AACGCCCAGT TCACCCACAC CGTCGGCAGC GGCGACTTCA TCCAGAACCA CAACTGGCCC 
0301 AACCAGAACG GCAACGACAT CGCCTTGATC CGCACCCCCC ACGT-GGACT TCTGGCACAT 
0361 GG-TTAACAA GGT-GGAGCT GCCCAGCTTC AACGATCGCT ACAACATGTA CG-ACAACTA 
0421 TTGGGCCGTC GCCTGCGGTT GGGGACTGAC CACCGCCGGA TCCCAGCCCG ATTGGATGGA 
0481 GTGCGTCGAC CTGCAGATCA TTAG 
 Assemble Data

8867R-1.IR_full       1   ACTGTCCAGCAGGTTCATCCCAAGGACCTGCCCAAGGACACCAAGATCAATGGCCGCATT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8867R-1.in silico     1   ACTGTCCAGCAGGTTCATCCCAAGGACCTGCCCAAGGACACCAAGATCAATGGCCGCATT 60


8867R-1.IR_full       61  GTGAACGGATATCCAGCCTACGAGGGCAAGGCTCCCTACACCGTGGGTCTGGGCTTCAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8867R-1.in silico     61  GTGAACGGATATCCAGCCTACGAGGGCAAGGCTCCCTACACCGTGGGTCTGGGCTTCAGC 120


8867R-1.IR_full       121 GGCAACGGCGGCTGGTGGTGCGGTGGTTCTATCATCGCCCACGATTGGGTCCTGACTGCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8867R-1.in silico     121 GGCAACGGCGGCTGGTGGTGCGGTGGTTCTATCATCGCCCACGATTGGGTCCTGACTGCT 180


8867R-1.IR_full       181 GCTCACTGCACCAACGGCGCCTCCCAGGTGACCATCTACTACGGAGCCACCTAGCGCACC 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
8867R-1.in silico     181 GCTCACTGCACCAACGGCGCCTCCCAGGTGACCATCTACTACGGAGCCACCTGGCGCACC 240


8867R-1.IR_full       241 AACGCCCAGTTCACCCACACCGTCGGCAGCGGCGACTTCATCCAGAACCACAACTGGCCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8867R-1.in silico     241 AACGCCCAGTTCACCCACACCGTCGGCAGCGGCGACTTCATCCAGAACCACAACTGGCCC 300


8867R-1.IR_full       301 AACCAGAACGGCAACGACATCGCCTTGATCCGCACCCCCCACGTGGGACTTCTGGCACAT 360
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
8867R-1.in silico     301 AACCAGAACGGCAACGACATCGCCTTGATCCGCACCCCCCACGT-GGACTTCTGGCACAT 360


8867R-1.IR_full       361 GGNTTAACAAGGTGGGAGCTGCCCAGCTTCAACGATCGCTACAACATGTACGAACAACTA 420
                          || |||||||||| |||||||||||||||||||||||||||||||||||||| |||||||
8867R-1.in silico     361 GG-TTAACAAGGT-GGAGCTGCCCAGCTTCAACGATCGCTACAACATGTACG-ACAACTA 420


8867R-1.IR_full       421 TTGGGCCGTCGCCTGCGGTTGGGGACTGACCACCGCCGGATCCCAGCCCGATTGGATGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8867R-1.in silico     421 TTGGGCCGTCGCCTGCGGTTGGGGACTGACCACCGCCGGATCCCAGCCCGATTGGATGGA 480


8867R-1.IR_full       481 GTGCGTCGACCTGCAGATCATTAG 504
                          ||||||||||||||||||||||||
8867R-1.in silico     481 GTGCGTCGACCTGCAGATCATTAG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
100   482  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
8.71   42  81  28  37  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
6.63   32  62  39  51  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
4.14   20  71  88  64  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
1.03   29  69  57  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0.82   33  39  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0.41   25  18  35  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0.41   52  NM_140084.1  CG18180-RA (CG18180), mRNA 
0.2   37  54  65  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0.2   24  48  54  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0.2   23  19  16  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0.2   19  74  75  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.2   14  73  92  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.2   13  90  52  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.2   NM_143286.1  CG5896-RB, transcript variant B (CG5896), mRNA 
0.2   NM_170318.1  CG5896-RA, transcript variant A (CG5896), mRNA 
0   13  27  17  NM_079220.1  CG6457-RA (yip7), mRNA 
0   15  18  NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_140096.3  CG18177-RB, transcript variant B (CG18177), mRNA 
0   NM_206310.1  CG18177-RA, transcript variant A (CG18177), mRNA 
0   18  25  NM_139753.1  CG10477-RA (CG10477), mRNA 
0   15  22  NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
0   15  NM_140737.1  CG6298-RA (Jon74E), mRNA 
0   NM_080153.3  CG10261-RA, transcript variant A (aPKC), mRNA 
0   NM_001043076.1  CG10261-RC, transcript variant C (aPKC), mRNA 
0   NM_001043080.1  CG10261-RD, transcript variant D (aPKC), mRNA 
0   NM_001043078.1  CG10261-RE, transcript variant E (aPKC), mRNA 
0   NM_001043079.1  CG10261-RB, transcript variant B (aPKC), mRNA 
0   NM_001043077.1  CG10261-RF, transcript variant F (aPKC), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.