National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8775R-3 
 Symbol CG32473  Full Name CG32473 
 CG No CG32473  Old CG No CG8775 
 Synonyms GM08240p, CG8775, CG11688, CG32473 
 Accession No (Link to NCBI) NM_169504.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCAGTCTCTCCACAGACGACA 
 Primer Seq. 3'
aatctagaggtaccCAGTACTTGCAGGCTGATGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCAGTCTCTC CACAGACGAC AATCACCGGA TCAAGGACAC CAATCGGCCC CACAAGGCCC 
0061 GCAGCAACAC GATCCTGACC CTCGCCGCAT TCTGCGTCTT TCTGCTAGTC CTCTGCGGCT 
0121 TCCTGCTGGG CGCCCTCGTC TACGTCGGCA AGAATATAGC CGAGGAGCAC CAGAGGCAGC 
0181 AGCACGCGAA TGCTTCCCAG TGGGCCTTGA ACTCCACCAT CCGCACAGTT TACGTGGATC 
0241 GGGACCAGTT GCTATCCACC AAGCCCATTA TCAGCGTACT TTCAGATAAT CGCTTTCACA 
0301 CCACTCAAGT GCCAACCAGC AAAAAAATCG AGCATAATGG CAACTGTGGC GCCCGCTGTA 
0361 AAAGCCGCGA GCAAGGTGCT CCAGAATCTG GGANTCCGGC TGCCCAAACA GATTAAGCCA 
0421 AGVAAGTACC GCCTTCATTT GCGCCCCGAT CTCGAAACGA AAGAACTATT CCGGCAATAA 
0481 TAAGCATCAG CCTGCAAGTA CTG 
 in silico PCR Fragment
0001 GCAGTCTCTC CACAGACGAC AATCACCGGA TCAAGGACAC CAATCGGCCC CACAAGGCCC 
0061 GCAGCAACAC GATCCTGACC CTCGCCGCAT TCTGCGTCTT TCTGCTAGTC CTCTGCGGCT 
0121 TCCTGCTGGG CGCCCTCGTC TACGTCGGCA AGAATATAGC CGAGGAGCAC CAGAGGCAGC 
0181 AGCACGCGAA TGCTTCCCAG TGGGCCTTGA ACTCCACCAT CCGCACAGTT TACGTGGATC 
0241 GGGACCAGTT GCTATCCACC AAGCCCATTA TCAGCGTACT TTCAGATAAT CGCTTTTACA 
0301 CGACTCAAGT GCCAACCAGC -AAAAAATCG AGCATAATGG CAACTGTGGC GCCCGCTGTA 
0361 AAAGCCGCGA GCAAGGTGCT CCAGAATCTG GGATTCCGGC TGCCCAAACA GATTAAGCCA 
0421 AGCAAGTACC GCCTTCATTT GCGCCCCGAT CTCG-AACGA AAGAACTATT CCGGCAAT-A 
0481 TAAGCATCAG CCTGCAAGTA CTG 
 Assemble Data

8775R-3.IR_full       1   GCAGTCTCTCCACAGACGACAATCACCGGATCAAGGACACCAATCGGCCCCACAAGGCCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8775R-3.in silico     1   GCAGTCTCTCCACAGACGACAATCACCGGATCAAGGACACCAATCGGCCCCACAAGGCCC 60


8775R-3.IR_full       61  GCAGCAACACGATCCTGACCCTCGCCGCATTCTGCGTCTTTCTGCTAGTCCTCTGCGGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8775R-3.in silico     61  GCAGCAACACGATCCTGACCCTCGCCGCATTCTGCGTCTTTCTGCTAGTCCTCTGCGGCT 120


8775R-3.IR_full       121 TCCTGCTGGGCGCCCTCGTCTACGTCGGCAAGAATATAGCCGAGGAGCACCAGAGGCAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8775R-3.in silico     121 TCCTGCTGGGCGCCCTCGTCTACGTCGGCAAGAATATAGCCGAGGAGCACCAGAGGCAGC 180


8775R-3.IR_full       181 AGCACGCGAATGCTTCCCAGTGGGCCTTGAACTCCACCATCCGCACAGTTTACGTGGATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8775R-3.in silico     181 AGCACGCGAATGCTTCCCAGTGGGCCTTGAACTCCACCATCCGCACAGTTTACGTGGATC 240


8775R-3.IR_full       241 GGGACCAGTTGCTATCCACCAAGCCCATTATCAGCGTACTTTCAGATAATCGCTTTCACA 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
8775R-3.in silico     241 GGGACCAGTTGCTATCCACCAAGCCCATTATCAGCGTACTTTCAGATAATCGCTTTTACA 300


8775R-3.IR_full       301 CCACTCAAGTGCCAACCAGCAAAAAAATCGAGCATAATGGCAACTGTGGCGCCCGCTGTA 360
                          | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
8775R-3.in silico     301 CGACTCAAGTGCCAACCAGC-AAAAAATCGAGCATAATGGCAACTGTGGCGCCCGCTGTA 360


8775R-3.IR_full       361 AAAGCCGCGAGCAAGGTGCTCCAGAATCTGGGANTCCGGCTGCCCAAACAGATTAAGCCA 420
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
8775R-3.in silico     361 AAAGCCGCGAGCAAGGTGCTCCAGAATCTGGGATTCCGGCTGCCCAAACAGATTAAGCCA 420


8775R-3.IR_full       421 AGVAAGTACCGCCTTCATTTGCGCCCCGATCTCGAAACGAAAGAACTATTCCGGCAATAA 480
                          || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
8775R-3.in silico     421 AGCAAGTACCGCCTTCATTTGCGCCCCGATCTCG-AACGAAAGAACTATTCCGGCAAT-A 480


8775R-3.IR_full       481 TAAGCATCAGCCTGCAAGTACTG 503
                          |||||||||||||||||||||||
8775R-3.in silico     481 TAAGCATCAGCCTGCAAGTACTG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169504.1  CG32473-RC, transcript variant C (CG32473), mRNA 
41.28   199  NM_142019.2  CG32473-RB, transcript variant B (CG32473), mRNA 
0   NM_166173.2  CG6262-RC, transcript variant C (CG6262), mRNA 
0   NM_166172.3  CG6262-RB, transcript variant B (CG6262), mRNA 
0   NM_137279.3  CG6262-RA, transcript variant A (CG6262), mRNA 
0   NM_140430.2  CG6603-RA, transcript variant A (Hsc70Cb), mRNA 
0   NM_168573.1  CG6603-RB, transcript variant B (Hsc70Cb), mRNA 
0   NM_168574.1  CG6603-RC, transcript variant C (Hsc70Cb), mRNA 
0   NM_165919.1  CG17759-RA, transcript variant A (Galpha49B), mRNA 
0   NM_165923.1  CG17759-RG, transcript variant G (Galpha49B), mRNA 
0   NM_165921.1  CG17759-RC, transcript variant C (Galpha49B), mRNA 
0   NM_165922.1  CG17759-RE, transcript variant E (Galpha49B), mRNA 
0   NM_078994.2  CG17759-RH, transcript variant H (Galpha49B), mRNA 
0   NM_165924.1  CG17759-RD, transcript variant D (Galpha49B), mRNA 
0   NM_165920.1  CG17759-RB, transcript variant B (Galpha49B), mRNA 
0   NM_165925.1  CG17759-RF, transcript variant F (Galpha49B), mRNA 
0   NM_057405.2  CG4244-RB, transcript variant B (Su(dx)), mRNA 
0   NM_143096.2  CG11851-RA (CG11851), mRNA 
0   NM_176425.1  CG9821-RB, transcript variant B (CG9821), mRNA 
0   NM_176424.1  CG9821-RA, transcript variant A (CG9821), mRNA 
0   NM_057867.2  CG8808-RA (Pdk), mRNA 
0   NM_057469.3  CG10718-RA (neb), mRNA 
0   NM_143197.1  CG6095-RA, transcript variant A (CG6095), mRNA 
0   NM_206576.1  CG6095-RB, transcript variant B (CG6095), mRNA 
0   NM_138129.2  CG16896-RA (CG16896), mRNA 
0   NM_206244.1  CG33232-RC, transcript variant C (CG33232), mRNA 
0   NM_001031933.1  CG33232-RD, transcript variant D (CG33232), mRNA 
0   NM_206246.1  CG33232-RA, transcript variant A (CG33232), mRNA 
0   NM_206245.1  CG33232-RB, transcript variant B (CG33232), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.