National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8727R-1 
 Symbol cyc  Full Name cycle 
 CG No CG8727  Old CG No CG8727 
 Synonyms CYC, Cyc, dCYC, dbmal, Cycle, Bmal1, dBMAL1, bmal1, dBma1, CYCLE, BMAL1, MOP3, bMAL1, dBmal, dBMAL, dbmal1, Mop3, CG8727, cyc 
 Accession No (Link to NCBI) NM_079444.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Karpowicz P, Zhang Y, Hogenesch JB, Emery P, Perrimon N.
The circadian clock gates the intestinal stem cell regenerative state.
Cell Rep (2013) 3(4) 996-1004 [ PubMed ID = 23583176 ] [ RRC reference ]

Chow ES, Long DM, Giebultowicz JM.
Circadian rhythm in mRNA expression of the glutathione synthesis gene Gclc is controlled by peripheral glial clocks in Drosophila melanogaster.
Physiol. Entomol. (2016) 41(4) 369-377 [ PubMed ID = 28503020 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGAAGTTCAGGAGTTCTGCG 
 Primer Seq. 3'
aatctagaggtaccCTGCTCCTTAACCTTGCCTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGAAGTTCA GGAGTTCTGC GAAAATATGG AGGAGATCGA AGATGAAAAC TACGACGAGG 
0061 AGAAGTCAGC TAGAACCTCG GATGAAAATC GCAAGCAAAA TCACAGCGAG ATCGAGAAGC 
0121 GGCGTCGGGA CAAGATGAAC ACGTACATCA ACGAGCTCTC CTCCATGATT CCCATGTGCT 
0181 TTGCGATGCA GCGAAAGCTG GACAAACTGA CTGTGCTCCG GATGGCAGTG CAGCATCTGC 
0241 GAGGGATCCG TGGCAGCGGC AGCTTACATC CATTCAACGG ATCCGATTAC CGGCCTAGCT 
0301 TCCTGTCCGA CCAGGAGCTC AAGATGATTA TCCTGCAAGC GTCGGAGGGA TTCCTGTTCG 
0361 TGGTGGGTTG TGACCGAGGA CGCATCCTGT ACGTTTCCGA TTCGGTGTCC AGTGTGCTGA 
0421 ACAGCACCCA AGCGGACCTG CTGGGACAGA GCTGGTTCGA CGTCCTGCAT CCGAAGGACA 
0481 TAGGCAAGGT TAAGGAGCAG  
 in silico PCR Fragment
0001 TGGAAGTTCA GGAGTTCTGC GAAAATATGG AGGAGATCGA AGATGAAAAC TACGACGAGG 
0061 AGAAGTCAGC TAGAACCTCG GATGAAAATC GCAAGCAAAA TCACAGCGAG ATCGAGAAGC 
0121 GGCGTCGGGA CAAGATGAAC ACGTACATCA ACGAGCTCTC CTCCATGATT CCCATGTGCT 
0181 TTGCGATGCA GCGAAAGCTG GACAAACTGA CTGTGCTCCG GATGGCAGTG CAGCATCTGC 
0241 GAGGGATCCG TGGCAGCGGC AGCTTACATC CATTCAACGG ATCCGATTAC CGGCCTAGCT 
0301 TCCTGTCCGA CCAGGAGCTC AAGATGATTA TCCTGCAAGC GTCGGAGGGA TTCCTGTTCG 
0361 TGGTGGGTTG TGACCGAGGA CGCATCCTGT ACGTTTCCGA TTCGGTGTCC AGTGTGCTGA 
0421 ACAGCACCCA AGCGGACCTG CTGGGACAGA GCTGGTTCGA CGTCCTGCAT CCGAAGGACA 
0481 TAGGCAAGGT TAAGGAGCAG  
 Assemble Data

8727R-1.IR_full       1   TGGAAGTTCAGGAGTTCTGCGAAAATATGGAGGAGATCGAAGATGAAAACTACGACGAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     1   TGGAAGTTCAGGAGTTCTGCGAAAATATGGAGGAGATCGAAGATGAAAACTACGACGAGG 60


8727R-1.IR_full       61  AGAAGTCAGCTAGAACCTCGGATGAAAATCGCAAGCAAAATCACAGCGAGATCGAGAAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     61  AGAAGTCAGCTAGAACCTCGGATGAAAATCGCAAGCAAAATCACAGCGAGATCGAGAAGC 120


8727R-1.IR_full       121 GGCGTCGGGACAAGATGAACACGTACATCAACGAGCTCTCCTCCATGATTCCCATGTGCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     121 GGCGTCGGGACAAGATGAACACGTACATCAACGAGCTCTCCTCCATGATTCCCATGTGCT 180


8727R-1.IR_full       181 TTGCGATGCAGCGAAAGCTGGACAAACTGACTGTGCTCCGGATGGCAGTGCAGCATCTGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     181 TTGCGATGCAGCGAAAGCTGGACAAACTGACTGTGCTCCGGATGGCAGTGCAGCATCTGC 240


8727R-1.IR_full       241 GAGGGATCCGTGGCAGCGGCAGCTTACATCCATTCAACGGATCCGATTACCGGCCTAGCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     241 GAGGGATCCGTGGCAGCGGCAGCTTACATCCATTCAACGGATCCGATTACCGGCCTAGCT 300


8727R-1.IR_full       301 TCCTGTCCGACCAGGAGCTCAAGATGATTATCCTGCAAGCGTCGGAGGGATTCCTGTTCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     301 TCCTGTCCGACCAGGAGCTCAAGATGATTATCCTGCAAGCGTCGGAGGGATTCCTGTTCG 360


8727R-1.IR_full       361 TGGTGGGTTGTGACCGAGGACGCATCCTGTACGTTTCCGATTCGGTGTCCAGTGTGCTGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     361 TGGTGGGTTGTGACCGAGGACGCATCCTGTACGTTTCCGATTCGGTGTCCAGTGTGCTGA 420


8727R-1.IR_full       421 ACAGCACCCAAGCGGACCTGCTGGGACAGAGCTGGTTCGACGTCCTGCATCCGAAGGACA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8727R-1.in silico     421 ACAGCACCCAAGCGGACCTGCTGGGACAGAGCTGGTTCGACGTCCTGCATCCGAAGGACA 480


8727R-1.IR_full       481 TAGGCAAGGTTAAGGAGCAG 500
                          ||||||||||||||||||||
8727R-1.in silico     481 TAGGCAAGGTTAAGGAGCAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079444.2  CG8727-RA (cyc), mRNA 
0   NM_169254.1  CG11987-RA (tgo), mRNA 
0   NM_079237.1  CG4321-RA (Cyp4d8), mRNA 
0   NM_132800.1  CG15642-RA (CG15642), mRNA 
0   NM_135034.1  CG15624-RA, transcript variant A (hoe2), mRNA 
0   NM_135397.2  CG13091-RA (CG13091), mRNA 
0   NM_001014466.1  CG15624-RB, transcript variant B (hoe2), mRNA 
0   NM_135634.1  CG16840-RA (Art8), mRNA 
0   NM_135650.2  CG6258-RA (RfC38), mRNA 
0   NM_139375.1  CG12105-RA (CG12105), mRNA 
0   NM_136440.4  CG11139-RA (p47), mRNA 
0   NM_142886.1  CG4393-RA (CG4393), mRNA 
0   NM_132935.1  CG9606-RA (Rrp45), mRNA 
0   NM_140280.2  CG5688-RA (Grip163), mRNA 
0   NM_170413.2  CG2304-RA, transcript variant A (Trc8), mRNA 
0   NM_206581.1  CG2304-RC, transcript variant C (Trc8), mRNA 
0   NM_170414.1  CG2304-RB, transcript variant B (Trc8), mRNA 
0   NM_206580.1  CG2304-RD, transcript variant D (Trc8), mRNA 
0   NM_168482.1  CG32095-RA (CG32095), mRNA 
0   NM_057489.3  CG4722-RA (bib), mRNA 
0   10  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_079292.4  CG8107-RA (CalpB), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_079478.3  CG5069-RA (croc), mRNA 
0   NM_169806.1  CG31235-RA (CG31235), mRNA 
0   NM_134559.1  CG1829-RA (Cyp6v1), mRNA 
0   NM_167743.1  CG1486-RB, transcript variant B (CG1486), mRNA 
0   NM_141274.1  CG2669-RA (CG2669), mRNA 
0   NM_134606.2  CG1486-RA, transcript variant A (CG1486), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.