National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8708R-2 
 Symbol CG8708  Full Name CG8708 
 CG No CG8708  Old CG No CG8708 
 Synonyms anon-WO0144478.10, anon-WO0140519.114, CG8708 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGCAAGTCTATTGTCGCGT 
 Primer Seq. 3'
aatctagaggtaccGCGTCGTTATAGTGGTGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8708R-2.IR full       1   CGAGTGCAAGTCNATTGTCGCGTTCCCTGCTAACAGAAGCTCCGNGNTCNAAGAATCGCT 60
                            |||||||||| ||||||||||||||||||||||||||||||| | || ||||||||||
8708R-2.in silico     1   --AGTGCAAGTCTATTGTCGCGTTCCCTGCTAACAGAAGCTCCGCGTTCTAAGAATCGCT 60


8708R-2.IR full       61  CGGTGTTTACCTTGATTGCTGGTTTGGTGGTCGGCTACTGCCTGGCTCAAATCTTCTCCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8708R-2.in silico     61  CGGTGTTTACCTTGATTGCTGGTTTGGTGGTCGGCTACTGCCTGGCTCAAATCTTCTCCA 120


8708R-2.IR full       121 GCATTGCGCCGCACGAGAGTCTCTATCCGTATCTCAGCAGACGGTTCAGCGATTCCCAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8708R-2.in silico     121 GCATTGCGCCGCACGAGAGTCTCTATCCGTATCTCAGCAGACGGTTCAGCGATTCCCAGG 180


8708R-2.IR full       181 TGGCCACCGGTGGTCAATTGGCTCCGGAGCAGAGCGGGTTGAAGCATGATCATCGCAACG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8708R-2.in silico     181 TGGCCACCGGTGGTCAATTGGCTCCGGAGCAGAGCGGGTTGAAGCATGATCATCGCAACG 240


8708R-2.IR full       241 ACAACGTCAGCGTGGCCGAGCAGTTGAAGAAGGAGGTACGCATCCTCTGCTGGGTGATGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8708R-2.in silico     241 ACAACGTCAGCGTGGCCGAGCAGTTGAAGAAGGAGGTACGCATCCTCTGCTGGGTGATGA 300


8708R-2.IR full       301 CCAATCCCACAAACCACAAGAAGAAGGCTCGCCATGTGAAGCGAACCTGGGGCAAGCGCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8708R-2.in silico     301 CCAATCCCACAAACCACAAGAAGAAGGCTCGCCATGTGAAGCGAACCTGGGGCAAGCGCT 360


8708R-2.IR full       361 GCAACATCTTGCTCTTCATGAGTTCCGGCGCGGATGAGGAGCTGCCCACCGTGAAGCTCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8708R-2.in silico     361 GCAACATCTTGCTCTTCATGAGTTCCGGCGCGGATGAGGAGCTGCCCACCGTGAAGCTCG 420


8708R-2.IR full       421 ACGTGGGCGAGGGACGGGAGAATCTATGGGCCAAGGTCAAGGAGGCGTTCAAGTACGTCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8708R-2.in silico     421 ACGTGGGCGAGGGACGGGAGAATCTATGGGCCAAGGTCAAGGAGGCGTTCAAGTACGTCT 480


8708R-2.IR full       481 ATCATCACCACTATAA------ 502
                          ||||||||||||||||      
8708R-2.in silico     481 ATCATCACCACTATAACGACGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_136516.2  CG8708-RA, transcript variant A (CG8708), mRNA 
100  482  NM_165594.1  CG8708-RB, transcript variant B (CG8708), mRNA 
0.2  NM_001015501.1  CG17629-PD.3 (CG17629), mRNA 
23  18  NM_135414.2  CG9520-RB, transcript variant B (CG9520), mRNA 
23  18  NM_164840.1  CG9520-RC, transcript variant C (CG9520), mRNA 
23  18  NM_164839.1  CG9520-RA, transcript variant A (CG9520), mRNA 
12  NM_001038765.1  twiggy CG7440-RB, transcript variant B (tgy), mRNA 
12  NM_133121.3  twiggy CG7440-RA, transcript variant A (tgy), mRNA 
NM_140803.1  CG14073-RB, transcript variant B (CG14073), mRNA 
NM_001014748.1  pickpocket 28 CG4805-RB, transcript variant B (ppk28), mRNA 
NM_132941.2  pickpocket 28 CG4805-RA, transcript variant A (ppk28), mRNA 
NM_132912.1  methuselah-like 1 CG4521-RA (mthl1), mRNA 
13  NM_166487.2  CG13492-RB, transcript variant B (CG13492), mRNA 
13  NM_137768.1  CG13492-RA, transcript variant A (CG13492), mRNA 
NM_080258.2  katanin 60 CG10229-RA (katanin-60), mRNA 
NM_136736.1  CG12900-RA (CG12900), mRNA 
NM_001038890.1  CG34056-RA (CG34056), mRNA 
NM_079725.2  Neurexin 1 CG7050-RA (Nrx-1), mRNA 
NM_080025.1  cut CG11387-RA, transcript variant A (ct), mRNA 
NM_079035.2  Transferrin 3 CG3666-RA (Tsf3), mRNA 
NM_137623.2  CG9143-RA (CG9143), mRNA 
NM_167842.1  CG13900-RA, transcript variant A (CG13900), mRNA 
NM_134873.1  CG3119-RA, transcript variant A (CG3119), mRNA 
NM_164504.1  CG3119-RB, transcript variant B (CG3119), mRNA 
NM_132193.1  CG1514-RA (CG1514), mRNA 
NM_001043113.1  zormin CG33484-RC, transcript variant C (zormin), mRNA 
NM_206240.1  zormin CG33484-RA, transcript variant A (zormin), mRNA 
NM_001043112.1  zormin CG33484-RB, transcript variant B (zormin), mRNA 
NM_001043114.1  zormin CG33484-RD, transcript variant D (zormin), mRNA 
NM_142752.1  CG13407-RA (CG13407), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.