National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8668R-2 
 Symbol CG8668  Full Name CG8668 
 CG No CG8668  Old CG No CG8668 
 Synonyms CG8668 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult pupal lehal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGCGCATGCTACGCTTCTTT 
 Primer Seq. 3'
aatctagaggtaccTCGGCAGAGCTGTTGTTGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8668R-2.IR full       1   ACGCGCATGCTACGCTTCTTTTTAGTCCTAATCGTGGTGATCCTAACCATTTTCATCTAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     1   ACGCGCATGCTACGCTTCTTTTTAGTCCTAATCGTGGTGATCCTAACCATTTTCATCTAC 60


8668R-2.IR full       61  GCCTCGTACTCAACGACTAGCACCCTCACAGCGAACCATGTGCACCCTGCGGCATCACCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     61  GCCTCGTACTCAACGACTAGCACCCTCACAGCGAACCATGTGCACCCTGCGGCATCACCG 120


8668R-2.IR full       121 CCACAGCAGCTGATTGGCAGTCATCCTGGGCGACAGCCCATGGACCAAGTGCCGCCAGTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     121 CCACAGCAGCTGATTGGCAGTCATCCTGGGCGACAGCCCATGGACCAAGTGCCGCCAGTC 180


8668R-2.IR full       181 AATAGCACGGATAAGGAGTACAATTCGCCACCTGGTGAAAGTTCGTCTAAGCAGCAAAGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     181 AATAGCACGGATAAGGAGTACAATTCGCCACCTGGTGAAAGTTCGTCTAAGCAGCAAAGC 240


8668R-2.IR full       241 GTATCCAGCAGACACTCGCAACAATTACCGCCGCAACAGGCAGAGATACACAAGAGGCAT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     241 GTATCCAGCAGACACTCGCAACAATTACCGCCGCAACAGGCAGAGATACACAAGAGGCAT 300


8668R-2.IR full       301 CCGCAGCACCGCCTGCCCACCATCGACGAGGATGCTCTGCTCGACGGTGGCTCCGCGGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     301 CCGCAGCACCGCCTGCCCACCATCGACGAGGATGCTCTGCTCGACGGTGGCTCCGCGGGC 360


8668R-2.IR full       361 GCCAGTCCCCAGGTTGGTGGCCCTGACCAAACGCCCAATGTTATGGCGGATGAGCTGCTG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     361 GCCAGTCCCCAGGTTGGTGGCCCTGACCAAACGCCCAATGTTATGGCGGATGAGCTGCTG 420


8668R-2.IR full       421 GAGGAGCANCAGTATGGNCAGAGTGTTGATGGCATCACAGGCAACATCAACAGTAGCACC 480
                          |||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||
8668R-2.in silico     421 GAGGAGCAGCAGTATGGTCAGAGTGTTGATGGCATCACAGGCAACATCAACAGTAGCACC 480


8668R-2.IR full       481 AACAACAACAGCTCTGCCGA 500
                          ||||||||||||||||||||
8668R-2.in silico     481 AACAACAACAGCTCTGCCGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_135340.2  CG8668-RA (CG8668), mRNA 
NM_168375.2  CG32052-RA (CG32052), mRNA 
10  32  NM_133012.2  CG32560-RA (CG32560), mRNA 
10  NM_079784.2  E(spl) region transcript m2 CG6104-RA (m2), mRNA 
NM_132156.2  CG8300-RA (CG8300), mRNA 
NM_137130.2  CG10131-RA (CG10131), mRNA 
11  31  NM_136647.2  Calmodulin-binding transcription activator CG8809-RA (Camta), mRNA 
17  NM_167418.1  CG9517-RB, transcript variant B (CG9517), mRNA 
17  NM_132752.2  CG9517-RA, transcript variant A (CG9517), mRNA 
NM_170379.2  CG31048-RA (CG31048), mRNA 
NM_140315.3  sodium chloride cotransporter 69 CG4357-RA, transcript variant A (Ncc69), mRNA 
NM_206344.1  sodium chloride cotransporter 69 CG4357-RB, transcript variant B (Ncc69), mRNA 
18  32  NM_134890.2  CG17265-RA (CG17265), mRNA 
10  47  NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
10  40  NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
10  26  NM_057215.3  abrupt CG4807-RB, transcript variant B (ab), mRNA 
10  26  NM_057214.3  abrupt CG4807-RA, transcript variant A (ab), mRNA 
12  NM_137871.2  CG3536-RA (CG3536), mRNA 
NM_078679.2  Cytochrome P450-18a1 CG6816-RB, transcript variant B (Cyp18a1), mRNA 
NM_167628.1  Cytochrome P450-18a1 CG6816-RA, transcript variant A (Cyp18a1), mRNA 
NM_079677.2  center divider CG6027-RA (cdi), mRNA 
NM_206290.1  CG33279-RA (CG33279), mRNA 
12  NM_136542.1  mXr CG30361-RA, transcript variant A (mXr), mRNA 
NM_165609.1  mXr CG30361-RB, transcript variant B (mXr), mRNA 
NM_206058.1  mXr CG30361-RC, transcript variant C (mXr), mRNA 
NM_136191.2  CG31688-RA (CG31688), mRNA 
35  177  NM_168571.2  CG32133-RA (CG32133), mRNA 
13  46  NM_169775.1  osa CG7467-RA, transcript variant A (osa), mRNA 
13  46  NM_079668.2  osa CG7467-RB, transcript variant B (osa), mRNA 
13  41  NM_206506.1  osa CG7467-RC, transcript variant C (osa), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.