National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8624R-1 
 Symbol melt  Full Name melted 
 CG No CG8624  Old CG No CG8624 
 Synonyms 1441/14, anon-WO03014152.10, CG8624, melt, melted, dMelt 
 Accession No (Link to NCBI) NM_079229.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev. Biol. (2017) 427(1) 61-71 [ PubMed ID = 28514643 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACAAAGTGCTCGCCAAACGC 
 Primer Seq. 3'
aatctagaggtaccATCACGGACTCCGTATGAGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACAAAGTGC TCGCCAAACG CGATCTCTCA AGAGCCGGAG ATCTCTTTTC CGTGCCGGAT 
0061 GCAGATATAG TCGACGACAT CACGGAGGTG CTTTCCGAGA TCAGTCCGAT CATCTCGCAC 
0121 GCTGACTATG TGAAGAACAA CAATGACCAG AGTGTGGTGG AGATCTGTGT GACACGGGTG 
0181 CTATCCTGCA TCCGGGAAAC GAAAACTGCG GAGCGATACT GTGCTGCTCT GGTGGATCTT 
0241 CTGAGAACCT GTCTGCTTTG GAACCTCCAA CCCTCGGGAA CAACAAAGGA AGAGCCACCC 
0301 CATGCCAAGA TTGCTGCCGA TATCATCTCT AGCATTTTTC TGAACTATGA CAAAAAAGAA 
0361 CTGATGAAAA TAGCCCTTNC CCGTCGCCGT GCAGTTCCTT CCGAAGGGAA ACCGTGAGCT 
0421 ATCGCGAAAC TTGGCCAGTT ACCTCTCACT GGCGGCCATC GATCACGCCG GCTTGCTGAG 
0481 CCCTCATACG GAGTCCGTGA T 
 in silico PCR Fragment
0001 AACAAAGTGC TCGCCAAACG CGATCTCTCA AGAGCCGGAG ATCTCTTTTC CGTGCCGGAT 
0061 GCAGATATAG TCGACGACAT CACGGAGGTG CTTTCCGAGA TCAGTCCGAT CATCTCGCAC 
0121 GCGGACTATG TGAAGAACAA CAATGACCAG AGTGTGGTGG AGATCTGTGT GACACGGGTG 
0181 CTATCCTGCA TCCGGGAAAC GAAAACTGCG GAGCGATACT GTGCTGCTCT GGTGGATCTT 
0241 CTGAGGACCT GTCTGCTATG GAACCTCCAA CCCTCGGGAA CAACAAAGGA AGAGCCACCC 
0301 CATGCCAAGA TTGCTGCCGA TATCATCTCT AGCATTTTCC TGAACTATGA CAAAAAAGAA 
0361 CTGATGAAAA TAGCCCTT-C CCGTCGCCGT GCAGTTCCTT CCGAAGGGAA ACCGTGAGCT 
0421 ATCGCGAAAC TTGGCCAGTT ACCTCTCACT GGCGGCCATC GATCACGCCG GCTTGCTGAG 
0481 CCCTCATACG GAGTCCGTGA T 
 Assemble Data

8624R-1.IR_full       1   AACAAAGTGCTCGCCAAACGCGATCTCTCAAGAGCCGGAGATCTCTTTTCCGTGCCGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8624R-1.in silico     1   AACAAAGTGCTCGCCAAACGCGATCTCTCAAGAGCCGGAGATCTCTTTTCCGTGCCGGAT 60


8624R-1.IR_full       61  GCAGATATAGTCGACGACATCACGGAGGTGCTTTCCGAGATCAGTCCGATCATCTCGCAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8624R-1.in silico     61  GCAGATATAGTCGACGACATCACGGAGGTGCTTTCCGAGATCAGTCCGATCATCTCGCAC 120


8624R-1.IR_full       121 GCTGACTATGTGAAGAACAACAATGACCAGAGTGTGGTGGAGATCTGTGTGACACGGGTG 180
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8624R-1.in silico     121 GCGGACTATGTGAAGAACAACAATGACCAGAGTGTGGTGGAGATCTGTGTGACACGGGTG 180


8624R-1.IR_full       181 CTATCCTGCATCCGGGAAACGAAAACTGCGGAGCGATACTGTGCTGCTCTGGTGGATCTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8624R-1.in silico     181 CTATCCTGCATCCGGGAAACGAAAACTGCGGAGCGATACTGTGCTGCTCTGGTGGATCTT 240


8624R-1.IR_full       241 CTGAGAACCTGTCTGCTTTGGAACCTCCAACCCTCGGGAACAACAAAGGAAGAGCCACCC 300
                          ||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8624R-1.in silico     241 CTGAGGACCTGTCTGCTATGGAACCTCCAACCCTCGGGAACAACAAAGGAAGAGCCACCC 300


8624R-1.IR_full       301 CATGCCAAGATTGCTGCCGATATCATCTCTAGCATTTTTCTGAACTATGACAAAAAAGAA 360
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
8624R-1.in silico     301 CATGCCAAGATTGCTGCCGATATCATCTCTAGCATTTTCCTGAACTATGACAAAAAAGAA 360


8624R-1.IR_full       361 CTGATGAAAATAGCCCTTNCCCGTCGCCGTGCAGTTCCTTCCGAAGGGAAACCGTGAGCT 420
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
8624R-1.in silico     361 CTGATGAAAATAGCCCTT-CCCGTCGCCGTGCAGTTCCTTCCGAAGGGAAACCGTGAGCT 420


8624R-1.IR_full       421 ATCGCGAAACTTGGCCAGTTACCTCTCACTGGCGGCCATCGATCACGCCGGCTTGCTGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8624R-1.in silico     421 ATCGCGAAACTTGGCCAGTTACCTCTCACTGGCGGCCATCGATCACGCCGGCTTGCTGAG 480


8624R-1.IR_full       481 CCCTCATACGGAGTCCGTGAT 501
                          |||||||||||||||||||||
8624R-1.in silico     481 CCCTCATACGGAGTCCGTGAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001014572.1  CG8624-RB, transcript variant B (melt), mRNA 
100   482  NM_079229.1  CG8624-RA, transcript variant A (melt), mRNA 
0   NM_164466.1  CG32463-RA (CG32463), mRNA 
0   NM_001038737.1  CG34052-RA (CG34052), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 
0   NM_164436.1  CG17646-RB, transcript variant B (CG17646), mRNA 
0   NM_132859.2  CG9066-RA (CG9066), mRNA 
0   NM_142458.2  CG7670-RA (CG7670), mRNA 
0   NM_136382.1  CG30445-RA (Tdc1), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_057429.3  CG9703-RA, transcript variant A (Axs), mRNA 
0   NM_001038760.1  CG9703-RB, transcript variant B (Axs), mRNA 
0   NM_079065.3  CG15113-RA (5-HT1B), mRNA 
0   NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0   NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
0   NM_164860.1  CG4389-RB, transcript variant B (CG4389), mRNA 
0   NM_135455.2  CG4389-RA, transcript variant A (CG4389), mRNA 
0   NM_170540.1  CG31004-RB, transcript variant B (CG31004), mRNA 
0   NM_170539.1  CG31004-RA, transcript variant A (CG31004), mRNA 
0   NM_166991.2  CG32779-RA (CG32779), mRNA 
0   NM_136673.2  CG1698-RA (CG1698), mRNA 
0   NM_143224.2  CG5455-RA, transcript variant A (CG5455), mRNA 
0   NM_170273.1  CG5455-RB, transcript variant B (CG5455), mRNA 
0   NM_170274.1  CG5455-RC, transcript variant C (CG5455), mRNA 
0   NM_166988.3  CG2947-RA, transcript variant A (CG2947), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_001014719.1  CG2947-RC, transcript variant C (CG2947), mRNA 
0   NM_166989.3  CG2947-RB, transcript variant B (CG2947), mRNA 
0   NM_130718.3  CG32789-RA (CG32789), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
DC
++ 
DM
VM
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.