National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8604R-2 
 Symbol Amph  Full Name Amphiphysin 
 CG No CG8604  Old CG No CG8604 
 Synonyms damph, dAmph, amph, CG8604, Damp, DAMP, Amp, Amph 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACTTGGGCAAAGTCGATCGC 
 Primer Seq. 3'
aatctagaggtaccAGCTCGTCATGCAGTTCCGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8604R-2.IR full       1   AACTTGGGCAAAGTCGATCGCACTGCG-ATGAAATCTTCGACGATCACCTGAACAACTTC 60
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
8604R-2.in silico     1   AACTTGGGCAAAGTCGATCGCACTGCGGATGAAATCTTCGACGATCACCTGAACAACTTC 60


8604R-2.IR full       61  AATCGCCAGCAGGNGNNTGCCAACAGATTACAAAAGGAGTTCAATAACTACATAAGATGT 120
                          ||||||||||||| |  |||||||||||||||||||||||||||||||||||||||||||
8604R-2.in silico     61  AATCGCCAGCAGGCGAGTGCCAACAGATTACAAAAGGAGTTCAATAACTACATAAGATGT 120


8604R-2.IR full       121 GTTCGCGCCGCACAAGCCGCCTCCAAGACTCTGATGGATTCCGTTTGCGAGATCTACGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8604R-2.in silico     121 GTTCGCGCCGCACAAGCCGCCTCCAAGACTCTGATGGATTCCGTTTGCGAGATCTACGAG 180


8604R-2.IR full       181 CCACAATGGAGCGGTTACGATGCCCTGCAAGCACAAACGGGTGCCTCGGAAAGTCTGTGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8604R-2.in silico     181 CCACAATGGAGCGGTTACGATGCCCTGCAAGCACAAACGGGTGCCTCGGAAAGTCTGTGG 240


8604R-2.IR full       241 GCGGACTTTGCGCACAAATTGGGGGATCAAGTCCTCATTCCGCTCAACACATACACCGGA 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
8604R-2.in silico     241 GCGGACTTTGCGCACAAATTGGGGGATCAAGTCCTCATTCCGCTCAACACATACACTGGA 300


8604R-2.IR full       301 CAGTTTCCCGAAATGAAGAAAAAAGTAGAGAAGCGCAACCGAAAGCTGATTGATTACGAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8604R-2.in silico     301 CAGTTTCCCGAAATGAAGAAAAAAGTAGAGAAGCGCAACCGAAAGCTGATTGATTACGAT 360


8604R-2.IR full       361 GGCCAACGACACTCGTTTCAGAATCTGCAGNCCAATGCCAACAAGCGCAAAGATGATGTC 420
                          |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
8604R-2.in silico     361 GGCCAACGACACTCGTTTCAGAATCTGCAGGCCAATGCCAACAAGCGCAAAGATGATGTC 420


8604R-2.IR full       421 AAACTAACCAAAGGACNCGAGCAGCTGGAGGAA-CTAGACGCACCTANGAAATCCTGAAC 480
                          |||||||||||||||| |||||||||||||||| ||||||||||||| ||||||||||||
8604R-2.in silico     421 AAACTAACCAAAGGACGCGAGCAGCTGGAGGAAGCTAGACGCACCTACGAAATCCTGAAC 480


8604R-2.IR full       481 ACGGAACTGCATGACGAGCT 500
                          ||||||||||||||||||||
8604R-2.in silico     481 ACGGAACTGCATGACGAGCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.