National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8595R-2 
 Symbol Toll-7  Full Name Toll-7 
 CG No CG8595  Old CG No CG8595 
 Synonyms dToll7, toll, dTLR7, Tl-7, CT24947, CG8595, Toll-7 
 Accession No (Link to NCBI) NM_079073.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Li G, Forero MG, Wentzell JS, Durmus I, Wolf R, Anthoney NC, Parker M, Jiang R, Hasenauer J, Strausfeld NJ, Heisenberg M, Hidalgo A.
A Toll-receptor map underlies structural brain plasticity.
Elife (2020) 9 [ PubMed ID = 32066523 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCGCCCAAGGAGAGCGAAT 
 Primer Seq. 3'
aatctagaggtaccACCACCGAGAGAGTCGGGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCGCCCAA GGAGAGCGAA TCGAGTGCCA GCGCCATGTT AGGCGCCGGA ACAGGAGCCG 
0061 CTGCCACAGT ATCGCTATCA GGCGACTACT CCTCGCTGCT GTCCAATGTG CCGGCCGCCT 
0121 CGCCGGTTCC GGCCAATCCA TCGCAACCCA GTGGCCCGGC CAACCAGTGC TCCTGGTCCT 
0181 ACAACGGCAC CAGTTCGGTG CACTGCGCCC TGCGTCNTCA TTGAGCGACA GCCGGGTCTG 
0241 GATCTCCAGG GCGCCGANTG CAGNTAGCCA GTTGACTATT CAGTGCAGCG AGCTCTACCT 
0301 CTTCGAATCA ACACTGCCCG TGGCAGTATT TTGCCAGGTT GCAGACCCTG GAGGCGCTGC 
0361 GTCTGGACTC GTGCAAGCTG CTCCAGTTGC CCAACAATGC CTTCGAGGGA TTGGCCACTC 
0421 TGAAATCCCT GCGCTTGAGC ACCCACAACA GTGAATgGGG TCCAACGAGG ACCCTGGAGC 
0481 TCTTCCCCGA CTCTCTCGGT GGT 
 in silico PCR Fragment
0001 TGGCGCCCAA GGAGAGCGAA TCGAGTGCCA GCGCCATGTT AGGCGCCGGA ACAGGAGCCG 
0061 CTGCCACAGT ATCGCTATCA GGCGACTACT CCTCGCTGCT GTCCAATGTG CCGGCCGCCT 
0121 CGCCGGTTCC GGCCAATCCA TCGCAACCCA GTGGCCCGGC CAACCAGTGC TCCTGGTCCT 
0181 ACAACGGCAC CAGTTCGGTG CACTGCGCCC TGCGTC-TCA TTGAGCGACA GCCGGGTCTG 
0241 GATCTCCAGG GCGCCGATGG CAG-TAGCCA GTTGACTATT CAGTGCAGCG AGCTCTACCT 
0301 CTTCGAATCA ACACTGCCCG TGGCAGTA-T TTGCCAGGTT GCAGACCCTG GAGGCGCTGC 
0361 GTCTGGACTC GTGCAAGCTG CTCCAGTTGC CCAACAATGC CTTCGAGGGA TTGGCCACTC 
0421 TGAAATCCCT GCGCTTGAGC ACCCACAACA GTGAATGGGG TCCAACGAGG ACCCTGGAGC 
0481 TCTTCCCCGA CTCTCTCGGT GGT 
 Assemble Data

8595R-2.IR_full       1   TGGCGCCCAAGGAGAGCGAATCGAGTGCCAGCGCCATGTTAGGCGCCGGAACAGGAGCCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8595R-2.in silico     1   TGGCGCCCAAGGAGAGCGAATCGAGTGCCAGCGCCATGTTAGGCGCCGGAACAGGAGCCG 60


8595R-2.IR_full       61  CTGCCACAGTATCGCTATCAGGCGACTACTCCTCGCTGCTGTCCAATGTGCCGGCCGCCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8595R-2.in silico     61  CTGCCACAGTATCGCTATCAGGCGACTACTCCTCGCTGCTGTCCAATGTGCCGGCCGCCT 120


8595R-2.IR_full       121 CGCCGGTTCCGGCCAATCCATCGCAACCCAGTGGCCCGGCCAACCAGTGCTCCTGGTCCT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8595R-2.in silico     121 CGCCGGTTCCGGCCAATCCATCGCAACCCAGTGGCCCGGCCAACCAGTGCTCCTGGTCCT 180


8595R-2.IR_full       181 ACAACGGCACCAGTTCGGTGCACTGCGCCCTGCGTCNTCATTGAGCGACAGCCGGGTCTG 240
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
8595R-2.in silico     181 ACAACGGCACCAGTTCGGTGCACTGCGCCCTGCGTC-TCATTGAGCGACAGCCGGGTCTG 240


8595R-2.IR_full       241 GATCTCCAGGGCGCCGANTGCAGNTAGCCAGTTGACTATTCAGTGCAGCGAGCTCTACCT 300
                          |||||||||||||||||  |||| ||||||||||||||||||||||||||||||||||||
8595R-2.in silico     241 GATCTCCAGGGCGCCGATGGCAG-TAGCCAGTTGACTATTCAGTGCAGCGAGCTCTACCT 300


8595R-2.IR_full       301 CTTCGAATCAACACTGCCCGTGGCAGTATTTTGCCAGGTTGCAGACCCTGGAGGCGCTGC 360
                          |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
8595R-2.in silico     301 CTTCGAATCAACACTGCCCGTGGCAGTA-TTTGCCAGGTTGCAGACCCTGGAGGCGCTGC 360


8595R-2.IR_full       361 GTCTGGACTCGTGCAAGCTGCTCCAGTTGCCCAACAATGCCTTCGAGGGATTGGCCACTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8595R-2.in silico     361 GTCTGGACTCGTGCAAGCTGCTCCAGTTGCCCAACAATGCCTTCGAGGGATTGGCCACTC 420


8595R-2.IR_full       421 TGAAATCCCTGCGCTTGAGCACCCACAACAGTGAATGGGGTCCAACGAGGACCCTGGAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8595R-2.in silico     421 TGAAATCCCTGCGCTTGAGCACCCACAACAGTGAATGGGGTCCAACGAGGACCCTGGAGC 480


8595R-2.IR_full       481 TCTTCCCCGACTCTCTCGGTGGT 503
                          |||||||||||||||||||||||
8595R-2.in silico     481 TCTTCCCCGACTCTCTCGGTGGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079073.1  CG8595-RA (Toll-7), mRNA 
0.2   NM_136502.2  CG14762-RA (CG14762), mRNA 
0.2   NM_001038757.1  CG9201-RC, transcript variant C (Grip128), mRNA 
0.2   NM_132802.2  CG9201-RB, transcript variant B (Grip128), mRNA 
0   NM_057466.2  CG8896-RA (18w), mRNA 
0   NM_164522.1  CG17257-RA, transcript variant A (CG17257), mRNA 
0   NM_134897.2  CG17257-RB, transcript variant B (CG17257), mRNA 
0   NM_140970.2  CG5199-RA (CG5199), mRNA 
0   NM_166063.1  CG10145-RA (mspo), mRNA 
0   NM_167040.2  CG3208-RA, transcript variant A (RhoGAP5A), mRNA 
0   NM_132007.2  CG3208-RB, transcript variant B (RhoGAP5A), mRNA 
0   NM_135768.2  CG16972-RA (CG16972), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_136555.1  CG8734-RA (CG8734), mRNA 
0   NM_139832.1  CG14829-RA (CG14829), mRNA 
0   NM_143422.1  CG11898-RA (CG11898), mRNA 
0   NM_169670.1  CG17604-RB, transcript variant B (c(3)G), mRNA 
0   NM_169671.1  CG17604-RC, transcript variant C (c(3)G), mRNA 
0   NM_142233.1  CG17604-RA, transcript variant A (c(3)G), mRNA 
0   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_137795.1  CG6613-RA (CG6613), mRNA 
0   NM_132709.1  CG12480-RA (CG12480), mRNA 
0   NM_137657.1  CG11110-RA (CG11110), mRNA 
0   NM_001038975.1  CG6919-RB, transcript variant B (oa2), mRNA 
0   NM_142800.1  CG6919-RA, transcript variant A (oa2), mRNA 
0   NM_141615.1  CG16734-RA (CG16734), mRNA 
0   NM_143714.2  CG4746-RA (mab-2), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   12  NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_137803.1  CG6758-RA (CG6758), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.