National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8544R-3 
 Symbol sd  Full Name scalloped 
 CG No CG8544  Old CG No CG8544 
 Synonyms sd, CG8544, Sd, EP(X)1088, DROEXO, DROEXO2, sp, l(1)G0239, l(1)G0262, l(1)G0309, l(1)G0483, clone 2.14, anon-EST:Liang-2.14, l(1)G0315, l(1)III, l(1)HF394, EP1088, spatula, scalloped, SD 
 Accession No (Link to NCBI) NM_078614.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ferguson GB, Martinez-Agosto JA.
Yorkie and Scalloped signaling regulates Notch-dependent lineage specification during Drosophila hematopoiesis.
Curr. Biol. (2014) 24(22) 2665-72 [ PubMed ID = 25454586 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAACAACCTGAGCTGCAGCG 
 Primer Seq. 3'
aatctagaggtaccGAAATCTTGGGACGTGCTTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGAACAACCT GAGCTGCAGC NNGTTGGAAG TTGCCGAGAA GACAGAACAA CAGGCAGTTG 
0061 GACCCGGCAC CATACCATCA CCGTGGACAC CAGTGAATGC CGGTCCTCCA GGCGCACTTG 
0121 GATCGGCAGA CACAAATGGC AGCATGGTGG ATAGCAAAAA CCTGGATGTC GGTGATATGA 
0181 GCGATGACGA AAAGGACTTG TCATCCGCTG ATGCCGAAGG TGTATGGAGT CCAGATATCG 
0241 AGCAGAGCTT TCAAGAGGCT TTATCTATAT ATCCGCCGTG NNCGGACGTA GAAAAATCAT 
0301 TTTATCCGAC GAGGGTAAAA TGTACGGTCG CAACGAGCTA ATCGCACGAT ATATAAAACT 
0361 GCGCACAGGC AAAACGAGAA CCAGGAAGCA AGTCAGTTCG CACATCCAAG TGCTGGCTCG 
0421 CCGTAAACTC CGCGAGATCC AGGCGAAAAT CAAAGTGCAA TTCTGGCAAC CTGGACTACA 
0481 GCCAAGCACG TCCCAAGATT TC 
 in silico PCR Fragment
0001 AGAACAACCT GAGCTGCAGC GAGTTGGAAG TTGCCGAGAA GACAGAACAA CAGGCAGTTG 
0061 GACCCGGCAC CATACCATCA CCGTGGACAC CAGTGAATGC CGGTCCTCCA GGCGCACTTG 
0121 GATCGGCAGA CACAAATGGC AGCATGGTGG ATAGCAAAAA CCTGGATGTC GGTGATATGA 
0181 GCGATGACGA AAAGGACTTG TCATCCGCTG ATGCCGAAGG TGTATGGAGT CCAGATATCG 
0241 AGCAGAGCTT TCAAGAGGCT TTATCTATAT ATCCGCCGTG --CGGACGTA GAAAAATCAT 
0301 TTTATCCGAC GAGGGTAAAA TGTACGGTCG CAACGAGCTA ATCGCACGAT ATATAAAACT 
0361 GCGCACAGGC AAAACGAGAA CCAGGAAGCA AGTCAGTTCG CACATCCAAG TGCTGGCTCG 
0421 CCGTAAACTC CGCGAGATCC AGGCGAAAAT CAAAGTGCAA TTCTGGCAAC CTGGACTACA 
0481 GCCAAGCACG TCCCAAGATT TC 
 Assemble Data

8544R-3.IR_full       1   AGAACAACCTGAGCTGCAGCNNGTTGGAAGTTGCCGAGAAGACAGAACAACAGGCAGTTG 60
                          ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
8544R-3.in silico     1   AGAACAACCTGAGCTGCAGCGAGTTGGAAGTTGCCGAGAAGACAGAACAACAGGCAGTTG 60


8544R-3.IR_full       61  GACCCGGCACCATACCATCACCGTGGACACCAGTGAATGCCGGTCCTCCAGGCGCACTTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8544R-3.in silico     61  GACCCGGCACCATACCATCACCGTGGACACCAGTGAATGCCGGTCCTCCAGGCGCACTTG 120


8544R-3.IR_full       121 GATCGGCAGACACAAATGGCAGCATGGTGGATAGCAAAAACCTGGATGTCGGTGATATGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8544R-3.in silico     121 GATCGGCAGACACAAATGGCAGCATGGTGGATAGCAAAAACCTGGATGTCGGTGATATGA 180


8544R-3.IR_full       181 GCGATGACGAAAAGGACTTGTCATCCGCTGATGCCGAAGGTGTATGGAGTCCAGATATCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8544R-3.in silico     181 GCGATGACGAAAAGGACTTGTCATCCGCTGATGCCGAAGGTGTATGGAGTCCAGATATCG 240


8544R-3.IR_full       241 AGCAGAGCTTTCAAGAGGCTTTATCTATATATCCGCCGTGNNCGGACGTAGAAAAATCAT 300
                          ||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||
8544R-3.in silico     241 AGCAGAGCTTTCAAGAGGCTTTATCTATATATCCGCCGTG--CGGACGTAGAAAAATCAT 300


8544R-3.IR_full       301 TTTATCCGACGAGGGTAAAATGTACGGTCGCAACGAGCTAATCGCACGATATATAAAACT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8544R-3.in silico     301 TTTATCCGACGAGGGTAAAATGTACGGTCGCAACGAGCTAATCGCACGATATATAAAACT 360


8544R-3.IR_full       361 GCGCACAGGCAAAACGAGAACCAGGAAGCAAGTCAGTTCGCACATCCAAGTGCTGGCTCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8544R-3.in silico     361 GCGCACAGGCAAAACGAGAACCAGGAAGCAAGTCAGTTCGCACATCCAAGTGCTGGCTCG 420


8544R-3.IR_full       421 CCGTAAACTCCGCGAGATCCAGGCGAAAATCAAAGTGCAATTCTGGCAACCTGGACTACA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8544R-3.in silico     421 CCGTAAACTCCGCGAGATCCAGGCGAAAATCAAAGTGCAATTCTGGCAACCTGGACTACA 480


8544R-3.IR_full       481 GCCAAGCACGTCCCAAGATTTC 502
                          ||||||||||||||||||||||
8544R-3.in silico     481 GCCAAGCACGTCCCAAGATTTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
87.55   422  NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
87.34   421  NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
0   NM_140046.2  CG4452-RA, transcript variant A (CG4452), mRNA 
0   NM_168328.1  CG4452-RB, transcript variant B (CG4452), mRNA 
0   NM_168329.1  CG4452-RC, transcript variant C (CG4452), mRNA 
0   NM_166935.1  CG2924-RA, transcript variant A (CG2924), mRNA 
0   NM_130638.2  CG2924-RC, transcript variant C (CG2924), mRNA 
0   NM_137076.1  CG6701-RA (CG6701), mRNA 
0   NM_140953.2  CG5605-RA, transcript variant A (eRF1), mRNA 
0   NM_168848.1  CG5605-RF, transcript variant F (eRF1), mRNA 
0   NM_176369.1  CG5605-RG, transcript variant G (eRF1), mRNA 
0   NM_168847.1  CG5605-RE, transcript variant E (eRF1), mRNA 
0   NM_168845.1  CG5605-RB, transcript variant B (eRF1), mRNA 
0   NM_168846.1  CG5605-RC, transcript variant C (eRF1), mRNA 
0   NM_165733.1  CG2264-RE, transcript variant E (CG2264), mRNA 
0   NM_165731.1  CG2264-RC, transcript variant C (CG2264), mRNA 
0   NM_165732.1  CG2264-RD, transcript variant D (CG2264), mRNA 
0   NM_165730.1  CG2264-RA, transcript variant A (CG2264), mRNA 
0   NM_136704.2  CG2264-RB, transcript variant B (CG2264), mRNA 
0   NM_168703.2  CG11661-RC, transcript variant C (Nc73EF), mRNA 
0   NM_176340.1  CG11661-RF, transcript variant F (Nc73EF), mRNA 
0   NM_176341.1  CG11661-RG, transcript variant G (Nc73EF), mRNA 
0   NM_168702.1  CG11661-RB, transcript variant B (Nc73EF), mRNA 
0   NM_168701.2  CG11661-RA, transcript variant A (Nc73EF), mRNA 
0   NM_168704.2  CG11661-RE, transcript variant E (Nc73EF), mRNA 
0   NM_176342.1  CG11661-RH, transcript variant H (Nc73EF), mRNA 
0   NM_079091.2  CG12781-RA, transcript variant A (nahoda), mRNA 
0   NM_166569.1  CG12781-RB, transcript variant B (nahoda), mRNA 
0   NM_136258.1  CG8674-RA (l(2)k14505), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.