National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8544R-2 
 Symbol sd  Full Name scalloped 
 CG No CG8544  Old CG No CG8544 
 Synonyms sd, CG8544, Sd, EP(X)1088, DROEXO, DROEXO2, sp, l(1)G0239, l(1)G0262, l(1)G0309, l(1)G0483, clone 2.14, anon-EST:Liang-2.14, l(1)G0315, l(1)III, l(1)HF394, EP1088, spatula, scalloped, SD 
 Accession No (Link to NCBI) NM_078614.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev Biol (2017) 427(1) 61-71 [ PubMed ID = 28514643 ] [ RRC reference ]

Doggett K, Grusche FA, Richardson HE, Brumby AM.
Loss of the Drosophila cell polarity regulator Scribbled promotes epithelial tissue overgrowth and cooperation with oncogenic Ras-Raf through impaired Hippo pathway signaling.
BMC Dev Biol (2011) 11 57 [ PubMed ID = 21955824 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||| silico     1   AGAACAACCTGAGCTGCAGCGAGTTGGAAGTTGCCGAGAAGACAGAACAACAGGCAGTTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACCCGGCACCATACCATCACCGTGGACACCAGTGAATGCCGGTCCTCCAGGCGCACTTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GATCGGCAGACACAAATGGCAGCATGGTGGATAGCAAAAACCTGGATGTCGGTGATATGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCGATGACGAAAAGGACTTGTCATCCGCTGATGCCGAAGGTGTATGGAGTCCAGATATCG 240

                          ||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| silico     241 AGCAGAGCTTTCAAGAGGCTTTATCTATATATCCGCCGTG--CGGACGTAGAAAAATCAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTTATCCGACGAGGGTAAAATGTACGGTCGCAACGAGCTAATCGCACGATATATAAAACT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGCACAGGCAAAACGAGAACCAGGAAGCAAGTCAGTTCGCACATCCAAGTGCTGGCTCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCGTAAACTCCGCGAGATCCAGGCGAAAATCAAAGTGCAATTCTGGCAACCTGGACTACA 480

8544R-2.IR_full       481 GCCAAGCACGTCCCAAGATTTC 502
                          |||||||||||||||||||||| silico     481 GCCAAGCACGTCCCAAGATTTC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
87.55   422  NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
87.34   421  NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
0   NM_140046.2  CG4452-RA, transcript variant A (CG4452), mRNA 
0   NM_168328.1  CG4452-RB, transcript variant B (CG4452), mRNA 
0   NM_168329.1  CG4452-RC, transcript variant C (CG4452), mRNA 
0   NM_166935.1  CG2924-RA, transcript variant A (CG2924), mRNA 
0   NM_130638.2  CG2924-RC, transcript variant C (CG2924), mRNA 
0   NM_137076.1  CG6701-RA (CG6701), mRNA 
0   NM_140953.2  CG5605-RA, transcript variant A (eRF1), mRNA 
0   NM_168848.1  CG5605-RF, transcript variant F (eRF1), mRNA 
0   NM_176369.1  CG5605-RG, transcript variant G (eRF1), mRNA 
0   NM_168847.1  CG5605-RE, transcript variant E (eRF1), mRNA 
0   NM_168845.1  CG5605-RB, transcript variant B (eRF1), mRNA 
0   NM_168846.1  CG5605-RC, transcript variant C (eRF1), mRNA 
0   NM_165733.1  CG2264-RE, transcript variant E (CG2264), mRNA 
0   NM_165731.1  CG2264-RC, transcript variant C (CG2264), mRNA 
0   NM_165732.1  CG2264-RD, transcript variant D (CG2264), mRNA 
0   NM_165730.1  CG2264-RA, transcript variant A (CG2264), mRNA 
0   NM_136704.2  CG2264-RB, transcript variant B (CG2264), mRNA 
0   NM_168703.2  CG11661-RC, transcript variant C (Nc73EF), mRNA 
0   NM_176340.1  CG11661-RF, transcript variant F (Nc73EF), mRNA 
0   NM_176341.1  CG11661-RG, transcript variant G (Nc73EF), mRNA 
0   NM_168702.1  CG11661-RB, transcript variant B (Nc73EF), mRNA 
0   NM_168701.2  CG11661-RA, transcript variant A (Nc73EF), mRNA 
0   NM_168704.2  CG11661-RE, transcript variant E (Nc73EF), mRNA 
0   NM_176342.1  CG11661-RH, transcript variant H (Nc73EF), mRNA 
0   NM_079091.2  CG12781-RA, transcript variant A (nahoda), mRNA 
0   NM_166569.1  CG12781-RB, transcript variant B (nahoda), mRNA 
0   NM_136258.1  CG8674-RA (l(2)k14505), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.