National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8542R-1 
 Symbol Hsc70-5  Full Name Heat shock protein cognate 5 
 CG No CG8542  Old CG No CG8542 
 Synonyms Hsc70, HSC-70, HSC70, Hsc5, l(2)k04907, hsc70, dhsc70, HSC5, CG8542, Hsc70-5 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Liaw GJ, Chiang CS.
Inactive Tlk associating with Tak1 increases p38 MAPK activity to prolong the G2 phase.
Sci Rep (2019) 9(1) 1885 [ PubMed ID = 30760733 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J Neurogenet (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCGGAGCTTCTAGCATGTTC 
 Primer Seq. 3'
aatctagaggtaccGCGTTCTTCACGGGAGTGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8542R-1.IR full       1   TCCGGAGCTTCTAGCATGTTCCGCAATCTGCCAGGTGCTAGCAATGGAATATCGTCCCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     1   TCCGGAGCTTCTAGCATGTTCCGCAATCTGCCAGGTGCTAGCAATGGAATATCGTCCCAG 60


8542R-1.IR full       61  CTGCGTTACAAGTCCGGTGAGGTCAAAGGTGCTGTTATTGGAATCGATCTGGGAACAACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     61  CTGCGTTACAAGTCCGGTGAGGTCAAAGGTGCTGTTATTGGAATCGATCTGGGAACAACC 120


8542R-1.IR full       121 AACTCCTGCCTGGCCGTCATGGAGGGCAAGCAGGCCAAGGTGATTGAAAACGCCGAGGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     121 AACTCCTGCCTGGCCGTCATGGAGGGCAAGCAGGCCAAGGTGATTGAAAACGCCGAGGGA 180


8542R-1.IR full       181 GCCCGGACCACACCCTCCCACGTCGCCTTTACCAAGGACGGTGAGCGGCTGGTCGGCATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     181 GCCCGGACCACACCCTCCCACGTCGCCTTTACCAAGGACGGTGAGCGGCTGGTCGGCATG 240


8542R-1.IR full       241 CCCGCCAAGCGCCAGGCAGTGACAAACTCGGCCAACACCTTCTATGCCACCAAGCGACTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     241 CCCGCCAAGCGCCAGGCAGTGACAAACTCGGCCAACACCTTCTATGCCACCAAGCGACTG 300


8542R-1.IR full       301 ATTGGCAGACGTTTTGATGATCCCGAGGTTAAGAAAGACATCACTAACCTGTCCTACAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     301 ATTGGCAGACGTTTTGATGATCCCGAGGTTAAGAAAGACATCACTAACCTGTCCTACAAG 360


8542R-1.IR full       361 GTGGTCAAGGCTTCAAATGGCGATGCCTGGGTCTCTTCCACCGACGGCAAGGTGTACTCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     361 GTGGTCAAGGCTTCAAATGGCGATGCCTGGGTCTCTTCCACCGACGGCAAGGTGTACTCT 420


8542R-1.IR full       421 CCATCCCAAATCGGTGCTTTCATCCTGATGAAGATGAAGGAAACCGCTGAGGCATACCTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8542R-1.in silico     421 CCATCCCAAATCGGTGCTTTCATCCTGATGAAGATGAAGGAAACCGCTGAGGCATACCTG 480


8542R-1.IR full       481 AACACTCCCGTGAAGAACGN 500
                          ||||||||||||||||||| 
8542R-1.in silico     481 AACACTCCCGTGAAGAACGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.