National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8491R-2 
 Symbol kto  Full Name kohtalo 
 CG No CG8491  Old CG No CG8491 
 Synonyms MED12, Med12, Kto, CG8491, Srb8/KTO/TRAP230, Trap230, dTRAP230, SRB8, Kto/Med12, kto 
 Accession No (Link to NCBI) NM_080047.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Terriente-Félix A, López-Varea A, de Celis JF.
Identification of genes affecting wing patterning through a loss-of-function mutagenesis screen and characterization of med15 function during wing development.
Genetics (2010) 185(2) 671-84 [ PubMed ID = 20233856 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGGTCCGCCGGACATCTATC 
 Primer Seq. 3'
aatctagaggtaccCTCGGCAGCCGGGTCGTAAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGGTCCGCC GGACATCTAT CCGCAGGACG CGAAGCAGCG AGAGGACGAG CTGACGCCCA 
0061 CGAATGTGAA GCACGGATTC ACGACGACGC CACCGCTGTC CGATGAATTC GGTACGGCCC 
0121 ACAACTCGAA TGTGAACGCC AGCAAAGTGA GCGCATTCTT TAGCGGCGTC CTGGCCAAGA 
0181 AGGAGGAGCT GATGACCCTG CCGGACACGG GGCGCAAGAA GCAGCAGATC AACTGCAAGG 
0241 ACAACTTCTG GCCCGTTTCG CCGCGTCGCA AGTGTACGGT GGACGCCTGG TTTAAGGACC 
0301 TCGCCGGTAA CAAACCCCTA CTTAGCCTAG CCAAACGGGC TCCATCGTTC AACAAGAAGG 
0361 AGGAGATCTT CATTACTCTG TGCGAGAACC AGGTGAACAT GCAACGCGCC ACCTGGTTCA 
0421 TCAAGCTGAG CGCCNGCCTA TACGCTTAGC TTCACCGAGT CTAAGAACAA AAAGCGATCC 
0481 ATTTACGACC CGGCTGCCGA G 
 in silico PCR Fragment
0001 TGGGTCCGCC GGACATCTAT CCGCAGGACG CGAAGCAGCG AGAGGACGAG CTGACGCCCA 
0061 CGAATGTGAA GCACGGATTC ACGACGACGC CACCGCTGTC CGATGAATTC GGTACGGCCC 
0121 ACAACTCGAA TGTGAACGCC AGCAAAGTGA GCGCATTCTT TAGCGGCGTC CTGGCCAAGA 
0181 AGGAGGAGCT GATGACCCTG CCGGACACGG GGCGCAAGAA GCAGCAGATC AACTGCAAGG 
0241 ACAACTTCTG GCCCGTTTCG CCGCGTCGCA AGTGTACGGT GGACGCCTGG TTTAAGGACC 
0301 TCGCCGGTAA CAAACCCCTA CTTAGCCTAG CCAAACGGGC TCCATCGTTC AACAAGAAGG 
0361 AGGAGATCTT CATTACTCTG TGCGAGAACC AGGTGAACAT GCAACGCGCC ACCTGGTTCA 
0421 TCAAGCTGAG CGCC-GCCTA TACGCTTAGC TTCACCGAGT CTAAGAACAA AAAGCGATCC 
0481 ATTTACGACC CGGCTGCCGA G 
 Assemble Data

10199R-2.IR_full       1   TTTGCCACCGGTTCCTTCGACCTGGACTTCCCCATACCAGACCTGATCGGCAAGACAGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     1   TTTGCCACCGGTTCCTTCGACCTGGACTTCCCCATACCAGACCTGATCGGCAAGACAGAA 60


10199R-2.IR_full       61  ATCCTTACAGAGGAGCATCGCGAGAAGCTCTGTTCACATCTGCCGGCTAGAGCCGAGGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     61  ATCCTTACAGAGGAGCATCGCGAGAAGCTCTGTTCACATCTGCCGGCTAGAGCCGAGGGA 120


10199R-2.IR_full       121 TACTCCTGGTCCCTGATCTTCAGCACCTCACAACATGGTTTCGCACTGAACTCCCTGTAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     121 TACTCCTGGTCCCTGATCTTCAGCACCTCACAACATGGTTTCGCACTGAACTCCCTGTAC 180


10199R-2.IR_full       181 CGCAAAATGGCGCGTCTGGAGAGTCCAGTTCTGATTGTCATTGAGGATACGGAGCACAAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     181 CGCAAAATGGCGCGTCTGGAGAGTCCAGTTCTGATTGTCATTGAGGATACGGAGCACAAC 240


10199R-2.IR_full       241 GTATTTGGTGCCCTCACCTCCTGCTCACTGCATGTGTCGGATCACTTTTACGGCACCGGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     241 GTATTTGGTGCCCTCACCTCCTGCTCACTGCATGTGTCGGATCACTTTTACGGCACCGGT 300


10199R-2.IR_full       301 GAGTCCCTGCTCTACAAGTTTAACCCCAGCTTCAAGGTGTTCCATTGGACTGGCGAGAAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     301 GAGTCCCTGCTCTACAAGTTTAACCCCAGCTTCAAGGTGTTCCATTGGACTGGCGAGAAT 360


10199R-2.IR_full       361 ATGTACTTCATCAAAGGAAACATGGAGAGCCTTTCGATTGGCGCTGGAGACGGTCGTTTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     361 ATGTACTTCATCAAAGGAAACATGGAGAGCCTTTCGATTGGCGCTGGAGACGGTCGTTTT 420


10199R-2.IR_full       421 GGNCTGTGGCTGGATGGTGATCTGAACCAGGGACGATCGCAACAGTGCAGCACATACGGC 480
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10199R-2.in silico     421 GGCCTGTGGCTGGATGGTGATCTGAACCAGGGACGATCGCAACAGTGCAGCACATACGGC 480


10199R-2.IR_full       481 AATGAGCCTCTGGCGCCACA 500
                           ||||||||||||||||||||
10199R-2.in silico     481 AATGAGCCTCTGGCGCCACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.