National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8491R-1 
 Symbol kto  Full Name kohtalo 
 CG No CG8491  Old CG No CG8491 
 Synonyms MED12, Med12, Kto, CG8491, Srb8/KTO/TRAP230, Trap230, dTRAP230, SRB8, Kto/Med12, kto 
 Accession No (Link to NCBI) NM_080047.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Mao F, Yang X, Fu L, Lv X, Zhang Z, Wu W, Yang S, Zhou Z, Zhang L, Zhao Y.
The Kto-Skd complex can regulate ptc expression by interacting with Cubitus interruptus (Ci) in the Hedgehog signaling pathway.
J. Biol. Chem. (2014) 289(32) 22333-41 [ PubMed ID = 24962581 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGGTCCGCCGGACATCTATCCGCAGGACGCGAAGCAGCGAGAGGACGAGCTGACGCCCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGAATGTGAAGCACGGATTCACGACGACGCCACCGCTGTCCGATGAATTCGGTACGGCCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACAACTCGAATGTGAACGCCAGCAAAGTGAGCGCATTCTTTAGCGGCGTCCTGGCCAAGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGAGGAGCTGATGACCCTGCCGGACACGGGGCGCAAGAAGCAGCAGATCAACTGCAAGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACAACTTCTGGCCCGTTTCGCCGCGTCGCAAGTGTACGGTGGACGCCTGGTTTAAGGACC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGCCGGTAACAAACCCCTACTTAGCCTAGCCAAACGGGCTCCATCGTTCAACAAGAAGG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGAGATCTTCATTACTCTGTGCGAGAACCAGGTGAACATGCAACGCGCCACCTGGTTCA 420

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCAAGCTGAGCGCC-GCCTATACGCTTAGCTTCACCGAGTCTAAGAACAAAAAGCGATCC 480

8491R-1.IR_full       481 ATTTACGACCCGGCTGCCGAG 501
                          ||||||||||||||||||||| silico     481 ATTTACGACCCGGCTGCCGAG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080047.2  CG8491-RA (kto), mRNA 
0.2   NM_166339.1  CG7225-RA (wbl), mRNA 
0   NM_168391.1  CG11989-RC, transcript variant C (Ard1), mRNA 
0   NM_140121.1  CG11989-RA, transcript variant A (Ard1), mRNA 
0   NM_168390.1  CG11989-RB, transcript variant B (Ard1), mRNA 
0   NM_168393.1  CG11989-RE, transcript variant E (Ard1), mRNA 
0   NM_168392.1  CG11989-RD, transcript variant D (Ard1), mRNA 
0   NM_135273.4  CG5229-RA (chm), mRNA 
0   NM_132615.1  CG4395-RA (CG4395), mRNA 
0   NM_165522.1  CG11112-RB, transcript variant B (CG11112), mRNA 
0   NM_001014603.1  CG32490-RJ, transcript variant J (cpx), mRNA 
0   NM_001014602.1  CG32490-RK, transcript variant K (cpx), mRNA 
0   NM_080280.2  CG32490-RE, transcript variant E (cpx), mRNA 
0   NM_164327.2  CG32490-RA, transcript variant A (cpx), mRNA 
0   NM_164330.2  CG32490-RC, transcript variant C (cpx), mRNA 
0   NM_164331.2  CG32490-RH, transcript variant H (cpx), mRNA 
0   NM_164328.2  CG32490-RG, transcript variant G (cpx), mRNA 
0   NM_164329.2  CG32490-RI, transcript variant I (cpx), mRNA 
0   NM_142201.1  CG14868-RA (CG14868), mRNA 
0   NM_131926.1  CG15570-RA (CG15570), mRNA 
0   NM_137901.1  CG9896-RA (CG9896), mRNA 
0   NM_080299.2  CG18531-RA (Gr2a), mRNA 
0   NM_168060.1  CG14991-RA, transcript variant A (Fit1), mRNA 
0   NM_139601.2  CG14991-RB, transcript variant B (Fit1), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_169212.1  CG7549-RB, transcript variant B (CG7549), mRNA 
0   NM_141337.1  CG2031-RA (Hpr1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.