National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8486R-3 
 Symbol CG8486  Full Name CG8486 
 CG No CG8486  Old CG No CG8486 
 Synonyms clone 1.32, anon-EST:Liang-1.32, CG8486 
 Accession No (Link to NCBI) NM_135344.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kim SE, Coste B, Chadha A, Cook B, Patapoutian A.
The role of Drosophila Piezo in mechanical nociception.
Nature (2012) 483(7388) 209-12 [ PubMed ID = 22343891 ] [ RRC reference ]

Tokusumi Y, Tokusumi T, Schulz RA.
The nociception genes painless and Piezo are required for the cellular immune response of Drosophila larvae to wasp parasitization.
Biochem. Biophys. Res. Commun. (2017) 486(4) 893-897 [ PubMed ID = 28342875 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGATGTTCTTTGTGTCGCCC 
 Primer Seq. 3'
aatctagaggtaccTGGCTGATCATGGACACTCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGATGTTCT TTGTGTCGCC CTTTGTTCCG CTGGCCACGC GACGCAACTT CAAAGGATCT 
0061 GTGACTGCCT TCTTCATCAT CCTGCTGACG TTGAGCACGC TGGTCCTCTT GGGTCACATA 
0121 ACGCTACAGA TTCTGGCGGT CAGCCTCACG CTGCCCATCT ACAATTGCTC GTTCAGTGAG 
0181 CGTCTGCTGC GTCACATTGG CTTCGTGAGC TTTATTGATC TACAGCCATT TGCCATCATC 
0241 GAATGGCTGG TGCCTGAGGT GTTGGTTTTC GCCACCTCCC TGGGTTCGTA TCTCACGGTG 
0301 AAGCGAGTGG CCTCACAGCC CGTCGGCGCC CGAGCAGCTG GAGAACGGCG AAGTGGTCGA 
0361 TGGTCAGGCG GAAAATGCCC AGACATCCTC TCAGCCATCT GCCGCAGATG CCAATGGAGG 
0421 AGATGTGCAA CAGGCCACGG TCACCTACGC CGCTGCAGCA ACAGCAGCAG CAGCTNGAGG 
0481 AAACGAGTGT CCATGATCAG CCA 
 in silico PCR Fragment
0001 TTGATGTTCT TTGTGTCGCC CTTTGTTCCG CTGGCCACGC GACGCAACTT CAAAGGATCT 
0061 GTGACTGCCT TCTTCATCAT CCTGCTGACG TTGAGCACGC TGGTCCTCTT GGGTCACATA 
0121 ACGCTACAGA TTCTGGCGGT CAGCCTCACG CTGCCCATCT ACAATTGCTC GTTCAGTGAG 
0181 CGTCTGCTGC GTCACATTGG CTTCGTGAGC TTTATTGATC TACAGCCATT TGCCATCATC 
0241 GAATGGCTAG TGCCTGAGGT GTTGGTTTTC GCCACCTCCC TGGGTTCGTA TCTCACGGTG 
0301 AAGCGAGTGG CCTCACAGCC CGTCGGCG-C CGAGCAGCTG GAGAACGGCG AGGTGGTCGA 
0361 TGGCCAGGCG GAAAACGCGC AGACATCTTC TCAGCCATCT GCCGCAGATG CCAATGGAGG 
0421 AGATGTGCAA CAGGCCACGG TCACC-ACGC CGCTGCAGCA ACAGCAGCAG CAGCT-GAGG 
0481 AAACGAGTGT CCATGATCAG CCA 
 Assemble Data

8486R-3.IR_full       1   TTGATGTTCTTTGTGTCGCCCTTTGTTCCGCTGGCCACGCGACGCAACTTCAAAGGATCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8486R-3.in silico     1   TTGATGTTCTTTGTGTCGCCCTTTGTTCCGCTGGCCACGCGACGCAACTTCAAAGGATCT 60


8486R-3.IR_full       61  GTGACTGCCTTCTTCATCATCCTGCTGACGTTGAGCACGCTGGTCCTCTTGGGTCACATA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8486R-3.in silico     61  GTGACTGCCTTCTTCATCATCCTGCTGACGTTGAGCACGCTGGTCCTCTTGGGTCACATA 120


8486R-3.IR_full       121 ACGCTACAGATTCTGGCGGTCAGCCTCACGCTGCCCATCTACAATTGCTCGTTCAGTGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8486R-3.in silico     121 ACGCTACAGATTCTGGCGGTCAGCCTCACGCTGCCCATCTACAATTGCTCGTTCAGTGAG 180


8486R-3.IR_full       181 CGTCTGCTGCGTCACATTGGCTTCGTGAGCTTTATTGATCTACAGCCATTTGCCATCATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8486R-3.in silico     181 CGTCTGCTGCGTCACATTGGCTTCGTGAGCTTTATTGATCTACAGCCATTTGCCATCATC 240


8486R-3.IR_full       241 GAATGGCTGGTGCCTGAGGTGTTGGTTTTCGCCACCTCCCTGGGTTCGTATCTCACGGTG 300
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
8486R-3.in silico     241 GAATGGCTAGTGCCTGAGGTGTTGGTTTTCGCCACCTCCCTGGGTTCGTATCTCACGGTG 300


8486R-3.IR_full       301 AAGCGAGTGGCCTCACAGCCCGTCGGCGCCCGAGCAGCTGGAGAACGGCGAAGTGGTCGA 360
                          |||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||
8486R-3.in silico     301 AAGCGAGTGGCCTCACAGCCCGTCGGCG-CCGAGCAGCTGGAGAACGGCGAGGTGGTCGA 360


8486R-3.IR_full       361 TGGTCAGGCGGAAAATGCCCAGACATCCTCTCAGCCATCTGCCGCAGATGCCAATGGAGG 420
                          ||| ||||||||||| || |||||||| ||||||||||||||||||||||||||||||||
8486R-3.in silico     361 TGGCCAGGCGGAAAACGCGCAGACATCTTCTCAGCCATCTGCCGCAGATGCCAATGGAGG 420


8486R-3.IR_full       421 AGATGTGCAACAGGCCACGGTCACCTACGCCGCTGCAGCAACAGCAGCAGCAGCTNGAGG 480
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||
8486R-3.in silico     421 AGATGTGCAACAGGCCACGGTCACC-ACGCCGCTGCAGCAACAGCAGCAGCAGCT-GAGG 480


8486R-3.IR_full       481 AAACGAGTGTCCATGATCAGCCA 503
                          |||||||||||||||||||||||
8486R-3.in silico     481 AAACGAGTGTCCATGATCAGCCA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  24  NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
100   482  24  NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
100   482  19  NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 
2.69   13  134  436  823  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
2.69   13  134  436  823  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
2.69   13  134  436  823  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
1.65   54  180  419  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.65   54  180  419  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.65   30  64  120  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
1.65   30  64  120  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
1.65   11  23  NM_164599.1  CG2950-RC, transcript variant C (CG2950), mRNA 
1.45   26  81  177  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
1.45   26  81  177  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
1.24   39  114  255  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
1.24   39  114  255  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
1.24   30  111  316  NM_139493.2  CG2083-RA (CG2083), mRNA 
1.24   21  38  79  NM_079938.3  CG2102-RA (cas), mRNA 
1.24   20  76  182  NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
1.24   20  76  182  NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
1.24   20  69  223  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
1.24   20  69  223  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
1.24   14  60  143  NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
1.24   14  60  141  NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
1.03   33  99  264  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
1.03   33  99  264  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
1.03   33  99  264  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
1.03   28  81  215  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
1.03   28  75  197  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
1.03   26  75  213  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
1.03   24  83  168  NM_167000.1  CG32778-RA (CG32778), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.