National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8470R-4 
 Symbol mRpS30  Full Name mitochondrial ribosomal protein S30 
 CG No CG8470  Old CG No CG8470 
 Synonyms mRSp30, MRP-S30, CG8470, mRpS30 
 Accession No (Link to NCBI) NM_078612.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kim MJ, Choe KM.
Basement membrane and cell integrity of self-tissues in maintaining Drosophila immunological tolerance.
PLoS Genet (2014) 10(10) e1004683 [ PubMed ID = 25329560 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTGAAGCTTAACCGTGTTCG 
 Primer Seq. 3'
aatctagaggtaccCAACGGGGTTCGATTCGGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTGAAGCTT AACCGTGTTC GCCATCTGCG AACGACGTAC AAGCGCTGTT TGTCCGGCCA 
0061 GTCGCAGCTG CAGCTGAATA GTACGGACGC AGAGCCGGCA TATCCGGAGA TTCAGGATCT 
0121 GTCCTTCAAG GCGCGCAAGC AGAAGGATGC GGCCAACTGG CACGAGGAAA TCCGGCAGGT 
0181 GCCGACCGGT GGAGGAGAAG ATGATCAAGA TCAATATGCC CCGCTATTAC GGCTTCAAGG 
0241 TGGTCGACTT CAACGACTCG AAAATCCCCT ACAATGCACT GCCGCTCACG CAACATTATA 
0301 CGCGCACAGT GCTCGAGGAT TTGCCATCTG AAACGGATAA GAAGGCACAG GCTAAGGACT 
0361 CCGAGCAGGA GCAGGAGCAG CCGAGCGTGG ATGGTCTTTT CAAGGCGGCT CGCGGGGATG 
0421 TTATTGATGC CCTCGAGTTT GCCCACGACT ACTACAAGCA TCTGGAAAAG CAACACAACT 
0481 CTGCCGAATC GAACCCCGTT G 
 in silico PCR Fragment
0001 GTTGAAGCTT AACCGTGTTC GCCATCTGCG AACGACGTAC AAGCGCTGTT TGTCCGGCCA 
0061 GTCGCAGCTG CAGCTGAATA GTACGGACGC AGAGCCGGCA TATCCGGAGA TTCAGGATCT 
0121 GTCCTTCAAG GCGCGCAAGC AGAAGGATGC GGCCAACTGG CACGAGGAAA TCCGGCAGGT 
0181 GCCGA-CGGT GGAGGAGAAG ATGATCAAGA TCAATATGCC CCGCTATTAC GGCTTCAAGG 
0241 TGGTCGACTT CAACGACTCG AAAATCCCCT ACAATGCACT GCCGCTCACG CAACATTATA 
0301 CGCGCACAGT GCTCGAGGAT TTGCCATCTG AAACGGATAA GAAGGCACAG GCTAAGGACT 
0361 CCGAGCAGGA GCAGGAGCAG CCGAGCGTGG ATGGTCTTTT CAAGGCGGCT CGCGGGGATG 
0421 TTATTGATGC CCTCGAGTTT GCCCACGACT ACTACAAGCA TCTGGAAAAG CAACACAACT 
0481 CTGCCGAATC GAACCCCGTT G 
 Assemble Data

8470R-4.IR_full       1   GTTGAAGCTTAACCGTGTTCGCCATCTGCGAACGACGTACAAGCGCTGTTTGTCCGGCCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     1   GTTGAAGCTTAACCGTGTTCGCCATCTGCGAACGACGTACAAGCGCTGTTTGTCCGGCCA 60


8470R-4.IR_full       61  GTCGCAGCTGCAGCTGAATAGTACGGACGCAGAGCCGGCATATCCGGAGATTCAGGATCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     61  GTCGCAGCTGCAGCTGAATAGTACGGACGCAGAGCCGGCATATCCGGAGATTCAGGATCT 120


8470R-4.IR_full       121 GTCCTTCAAGGCGCGCAAGCAGAAGGATGCGGCCAACTGGCACGAGGAAATCCGGCAGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     121 GTCCTTCAAGGCGCGCAAGCAGAAGGATGCGGCCAACTGGCACGAGGAAATCCGGCAGGT 180


8470R-4.IR_full       181 GCCGACCGGTGGAGGAGAAGATGATCAAGATCAATATGCCCCGCTATTACGGCTTCAAGG 240
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     181 GCCGA-CGGTGGAGGAGAAGATGATCAAGATCAATATGCCCCGCTATTACGGCTTCAAGG 240


8470R-4.IR_full       241 TGGTCGACTTCAACGACTCGAAAATCCCCTACAATGCACTGCCGCTCACGCAACATTATA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     241 TGGTCGACTTCAACGACTCGAAAATCCCCTACAATGCACTGCCGCTCACGCAACATTATA 300


8470R-4.IR_full       301 CGCGCACAGTGCTCGAGGATTTGCCATCTGAAACGGATAAGAAGGCACAGGCTAAGGACT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     301 CGCGCACAGTGCTCGAGGATTTGCCATCTGAAACGGATAAGAAGGCACAGGCTAAGGACT 360


8470R-4.IR_full       361 CCGAGCAGGAGCAGGAGCAGCCGAGCGTGGATGGTCTTTTCAAGGCGGCTCGCGGGGATG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     361 CCGAGCAGGAGCAGGAGCAGCCGAGCGTGGATGGTCTTTTCAAGGCGGCTCGCGGGGATG 420


8470R-4.IR_full       421 TTATTGATGCCCTCGAGTTTGCCCACGACTACTACAAGCATCTGGAAAAGCAACACAACT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8470R-4.in silico     421 TTATTGATGCCCTCGAGTTTGCCCACGACTACTACAAGCATCTGGAAAAGCAACACAACT 480


8470R-4.IR_full       481 CTGCCGAATCGAACCCCGTTG 501
                          |||||||||||||||||||||
8470R-4.in silico     481 CTGCCGAATCGAACCCCGTTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078612.2  CG8470-RA (mRpS30), mRNA 
0.2   12  NM_136732.1  CG12904-RA (CG12904), mRNA 
0.2   16  NM_132606.1  CG3754-RA (CG3754), mRNA 
0   19  47  NM_133159.1  CG14200-RA (CG14200), mRNA 
0   NM_137836.1  CG12489-RA (Dnr1), mRNA 
0   NM_135559.2  CG5337-RA (CG5337), mRNA 
0   13  NM_132521.2  CG1578-RA (CG1578), mRNA 
0   NM_078603.2  CG10952-RA, transcript variant A (eag), mRNA 
0   NM_001042810.1  CG10952-RB, transcript variant B (eag), mRNA 
0   NM_135124.1  CG14001-RA (bchs), mRNA 
0   NM_080356.2  CG5993-RA (os), mRNA 
0   15  NM_170450.1  CG31036-RA (CG31036), mRNA 
0   NM_168368.1  CG32044-RA (CG32044), mRNA 
0   20  NM_144453.2  CG13061-RA (Nplp3), mRNA 
0   13  NM_132392.1  CG12641-RA (CG12641), mRNA 
0   NM_001038748.1  CG33962-RA (Cp7Fa), mRNA 
0   NM_137534.1  CG15082-RA (CG15082), mRNA 
0   16  NM_169451.1  CG31361-RA, transcript variant A (dpr17), mRNA 
0   10  NM_169452.1  CG31361-RB, transcript variant B (dpr17), mRNA 
0   NM_164645.1  CG31915-RA (CG31915), mRNA 
0   23  NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0   11  NM_140112.1  CG14165-RA (CG14165), mRNA 
0   11  NM_001038758.1  CG9908-RB, transcript variant B (disco), mRNA 
0   11  NM_078638.2  CG9908-RA, transcript variant A (disco), mRNA 
0   NM_136882.2  CG30040-RA (jeb), mRNA 
0   17  NM_134505.1  CG14230-RA (CG14230), mRNA 
0   NM_133052.1  CG15058-RA (CG15058), mRNA 
0   NM_143325.2  CG12876-RA (CG12876), mRNA 
0   28  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0   14  NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.