National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8456R-3 
 Symbol CG30463  Full Name CG30463 
 CG No CG30463  Old CG No CG8456 
 Synonyms CG15713, CG8463, CG8456, CG30463 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGACAACATTTATCCCGAGC 
 Primer Seq. 3'
aatctagaggtaccACTCCTCCATCAGCAGCTTGT 
 Predicted Fragment Size
375 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8456R-3.IR full       1   TGGACAACATTTATCCCGAGCTCTTCATTCCCGGCGATTCTGTGGCCCACGGAGAGATAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-3.in silico     1   TGGACAACATTTATCCCGAGCTCTTCATTCCCGGCGATTCTGTGGCCCACGGAGAGATAA 60


8456R-3.IR full       61  GAAATCTAGGTTATGGCGGTCGCACCTGCTTGGACGCACCGGCTGGCAAGAAGCACCAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-3.in silico     61  GAAATCTAGGTTATGGCGGTCGCACCTGCTTGGACGCACCGGCTGGCAAGAAGCACCAGA 120


8456R-3.IR full       121 AGAAGGCGGTGGGCACGTATCCCTGCCATCGGCAGGGTGGAAACCAGTACTGGATGCTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-3.in silico     121 AGAAGGCGGTGGGCACGTATCCCTGCCATCGGCAGGGTGGAAACCAGTACTGGATGCTCA 180


8456R-3.IR full       181 GCAAGGCGGGCGAAATCCGTCGCGACGACTCCTGTCTCGATTATGCCGGCAAGGATGTGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-3.in silico     181 GCAAGGCGGGCGAAATCCGTCGCGACGACTCCTGTCTCGATTATGCCGGCAAGGATGTGA 240


8456R-3.IR full       241 CGCTTTTCGGCTGCCACGGGGGCAAAGGAAATCAGTTCTGGACGTACCGCGAGAACACAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-3.in silico     241 CGCTTTTCGGCTGCCACGGGGGCAAAGGAAATCAGTTCTGGACGTACCGCGAGAACACAA 300


8456R-3.IR full       301 AGCAGCTGCACCACGGCACCTCCGGCAAGTGTCTGGCCATCAGCGAGAGCAAGGACAAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-3.in silico     301 AGCAGCTGCACCACGGCACCTCCGGCAAGTGTCTGGCCATCAGCGAGAGCAAGGACAAGC 360


8456R-3.IR full       361 TGCTGATGGAGGAGT 375
                          |||||||||||||||
8456R-3.in silico     361 TGCTGATGGAGGAGT 375

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  467  NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
100  467  NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 
0.42  NM_142577.1  ire-1 CG4583-RA (ire-1), mRNA 
NM_140093.1  CG18178-RA (CG18178), mRNA 
NM_001042873.1  polypeptide GalNAc transferase 5 CG31651-RB, transcript variant B (pgant5), mRNA 
NM_135062.3  polypeptide GalNAc transferase 5 CG31651-RA, transcript variant A (pgant5), mRNA 
NM_079671.2  stripe CG7847-RA, transcript variant A (sr), mRNA 
NM_141054.1  spermatocyte arrest CG11308-RA (sa), mRNA 
NM_136041.1  Phosphodiesterase 11 CG10231-RA (Pde11), mRNA 
NM_058115.3  TBP-associated factor 10 CG2859-RA (Taf10), mRNA 
NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
NM_079163.2  mutator 2 CG1960-RA, transcript variant A (mu2), mRNA 
NM_166688.1  CG30426-RA (CG30426), mRNA 
NM_167927.1  mutator 2 CG1960-RB, transcript variant B (mu2), mRNA 
NM_139892.1  CG12262-RA (CG12262), mRNA 
NM_136412.2  polypeptide GalNAc transferase 3 CG4445-RA (pgant3), mRNA 
NM_143086.2  distal antenna-related CG13651-RA (danr), mRNA 
NM_169898.1  CG4288-RA, transcript variant A (CG4288), mRNA 
NM_142632.2  CG4288-RB, transcript variant B (CG4288), mRNA 
NM_142255.2  CG4221-RA (CG4221), mRNA 
NM_168183.1  CG32388-RA (CG32388), mRNA 
NM_142418.1  CG14317-RA (CG14317), mRNA 
NM_167387.1  CG32611-RB (CG32611), mRNA 
NM_078867.2  Dynein heavy chain at 36C CG5526-RA (Dhc36C), mRNA 
NM_057643.2  Ryanodine receptor 44F CG10844-RA, transcript variant A (Rya-r44F), mRNA 
NM_057644.2  Ryanodine receptor 44F CG10844-RB, transcript variant B (Rya-r44F), mRNA 
NM_057646.2  Ryanodine receptor 44F CG10844-RD, transcript variant D (Rya-r44F), mRNA 
NM_057645.2  Ryanodine receptor 44F CG10844-RC, transcript variant C (Rya-r44F), mRNA 
NM_170624.1  CG17034-RB, transcript variant B (CG17034), mRNA 
100  357  NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
100  357  NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 
NM_057894.3  defective proventriculus CG5799-RA, transcript variant A (dve), mRNA 
NM_057893.3  defective proventriculus CG5799-RB, transcript variant B (dve), mRNA 
NM_140744.1  TORC CG6064-RA (TORC), mRNA 
NM_079086.2  quaking related 58E-2 CG5821-RA (qkr58E-2), mRNA 
NM_138188.1  CG1231-RA (CG1231), mRNA 
NM_080318.2  Syntaxin 4 CG2715-RA (Syx4), mRNA 
NM_137209.2  CG8214-RA (CG8214), mRNA 
NM_143323.3  CG12880-RA (CG12880), mRNA 
NM_176066.2  CG9331-RC, transcript variant C (CG9331), mRNA 
NM_165345.1  CG9331-RA, transcript variant A (CG9331), mRNA 
NM_136218.2  CG9331-RB, transcript variant B (CG9331), mRNA 
NM_169357.1  Mediator complex subunit 7 CG31390-RA (MED7), mRNA 
NM_206015.1  CG9331-RE, transcript variant E (CG9331), mRNA 
NM_176067.1  CG9331-RD, transcript variant D (CG9331), mRNA 
NM_167069.1  CG15891-RA, transcript variant A (CG15891), mRNA 
NM_001031869.1  CG15892-RB, transcript variant B (CG15892), mRNA 
NM_135232.1  CG17375-RA (CG17375), mRNA 
NM_079472.2  Acetyl Coenzyme A synthase CG9390-RB, transcript variant B (AcCoAS), mRNA 
NM_168894.1  Acetyl Coenzyme A synthase CG9390-RA, transcript variant A (AcCoAS), mRNA 
NM_001014599.1  Acetyl Coenzyme A synthase CG9390-RC, transcript variant C (AcCoAS), mRNA 
NM_167424.1  CG32594-RC, transcript variant C (CG32594), mRNA 
NM_132762.3  CG32594-RB, transcript variant B (CG32594), mRNA 
NM_132959.2  CG8949-RA (CG8949), mRNA 
NM_142684.2  CG5745-RA (CG5745), mRNA 
NM_169851.1  CG31475-RA (CG31475), mRNA 
NM_139687.2  CG10671-RA, transcript variant A (CG10671), mRNA 
NM_168110.2  CG10671-RB, transcript variant B (CG10671), mRNA 
NM_167287.1  Cyp4g15 CG11715-RB, transcript variant B (Cyp4g15), mRNA 
100  482  NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
100  482  NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 
0.41  NM_142577.1  ire-1 CG4583-RA (ire-1), mRNA 
0.2  NM_167735.1  CG32521-RB, transcript variant B (CG32521), mRNA 
0.2  NM_167734.1  CG32521-RA, transcript variant A (CG32521), mRNA 
NM_166341.1  CG30127-RA (CG30127), mRNA 
NM_141759.1  CG14686-RA (CG14686), mRNA 
NM_138229.1  CG13908-RA (CG13908), mRNA 
11  NM_206506.1  osa CG7467-RC, transcript variant C (osa), mRNA 
11  NM_079668.2  osa CG7467-RB, transcript variant B (osa), mRNA 
11  NM_169775.1  osa CG7467-RA, transcript variant A (osa), mRNA 
NM_169278.2  CG9356-RB, transcript variant B (CG9356), mRNA 
NM_141632.1  CG9356-RA, transcript variant A (CG9356), mRNA 
12  NM_134497.1  CG14223-RA (CG14223), mRNA 
NM_141137.1  CG11426-RA (CG11426), mRNA 
NM_080085.2  optic ganglion reduced CG3039-RA, transcript variant A (ogre), mRNA 
NM_079463.2  knirps CG4717-RA (kni), mRNA 
NM_135229.2  CG17378-RA, transcript variant A (CG17378), mRNA 
NM_167620.2  CG32547-RA (CG32547), mRNA 
NM_165483.1  Tyrosine decarboxylase 2 CG30446-RA (Tdc2), mRNA 
NM_143086.2  distal antenna-related CG13651-RA (danr), mRNA 
NM_168680.1  zetaCOP CG3948-RB, transcript variant B (zetaCOP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.