National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8456R-1 
 Symbol CG30463  Full Name CG30463 
 CG No CG30463  Old CG No CG8456 
 Synonyms CG15713, CG8463, CG8456, CG30463 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult (late pupal lethal) 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGACAACATTTATCCCGAGC 
 Primer Seq. 3'
aatctagaggtaccACTCCTCCATCAGCAGCTTGT 
 Predicted Fragment Size
375 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8456R-1.IR full       1   TGGACAACATTTATCCCGAGCTCTTCATTCCCGGCGATTCTGTGGCCCACGGAGAGATAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-1.in silico     1   TGGACAACATTTATCCCGAGCTCTTCATTCCCGGCGATTCTGTGGCCCACGGAGAGATAA 60


8456R-1.IR full       61  GAAATCTAGGTTATGGCGGTCGCACCTGCTTGGACGCACCGGCTGGCAAGAAGCACCAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-1.in silico     61  GAAATCTAGGTTATGGCGGTCGCACCTGCTTGGACGCACCGGCTGGCAAGAAGCACCAGA 120


8456R-1.IR full       121 AGAAGGCGGTGGGCACGTATCCCTGCCATCGGCAGGGTGGAAACCAGTACTGGATGCTCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-1.in silico     121 AGAAGGCGGTGGGCACGTATCCCTGCCATCGGCAGGGTGGAAACCAGTACTGGATGCTCA 180


8456R-1.IR full       181 GCAAGGCGGGCGAAATCCGTCGCGACGACTCCTGTCTCGATTATGCCGGCAAGGATGTGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-1.in silico     181 GCAAGGCGGGCGAAATCCGTCGCGACGACTCCTGTCTCGATTATGCCGGCAAGGATGTGA 240


8456R-1.IR full       241 CGCTTTTCGGCTGCCACGGGGGCAAAGGAAATCAGTTCTGGACGTACCGCGAGAACACAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-1.in silico     241 CGCTTTTCGGCTGCCACGGGGGCAAAGGAAATCAGTTCTGGACGTACCGCGAGAACACAA 300


8456R-1.IR full       301 AGCAGCTGCACCACGGCACCTCCGGCAAGTGTCTGGCCATCAGCGAGAGCAAGGACAAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8456R-1.in silico     301 AGCAGCTGCACCACGGCACCTCCGGCAAGTGTCTGGCCATCAGCGAGAGCAAGGACAAGC 360


8456R-1.IR full       361 TGCTGATGGAGGAGT 375
                          |||||||||||||||
8456R-1.in silico     361 TGCTGATGGAGGAGT 375

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  467  NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
100  467  NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 
0.42  NM_142577.1  ire-1 CG4583-RA (ire-1), mRNA 
NM_140093.1  CG18178-RA (CG18178), mRNA 
NM_001042873.1  polypeptide GalNAc transferase 5 CG31651-RB, transcript variant B (pgant5), mRNA 
NM_135062.3  polypeptide GalNAc transferase 5 CG31651-RA, transcript variant A (pgant5), mRNA 
NM_079671.2  stripe CG7847-RA, transcript variant A (sr), mRNA 
NM_141054.1  spermatocyte arrest CG11308-RA (sa), mRNA 
NM_136041.1  Phosphodiesterase 11 CG10231-RA (Pde11), mRNA 
NM_058115.3  TBP-associated factor 10 CG2859-RA (Taf10), mRNA 
NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
NM_079163.2  mutator 2 CG1960-RA, transcript variant A (mu2), mRNA 
NM_166688.1  CG30426-RA (CG30426), mRNA 
NM_167927.1  mutator 2 CG1960-RB, transcript variant B (mu2), mRNA 
NM_139892.1  CG12262-RA (CG12262), mRNA 
NM_136412.2  polypeptide GalNAc transferase 3 CG4445-RA (pgant3), mRNA 
NM_143086.2  distal antenna-related CG13651-RA (danr), mRNA 
NM_169898.1  CG4288-RA, transcript variant A (CG4288), mRNA 
NM_142632.2  CG4288-RB, transcript variant B (CG4288), mRNA 
NM_142255.2  CG4221-RA (CG4221), mRNA 
NM_168183.1  CG32388-RA (CG32388), mRNA 
NM_142418.1  CG14317-RA (CG14317), mRNA 
NM_167387.1  CG32611-RB (CG32611), mRNA 
NM_078867.2  Dynein heavy chain at 36C CG5526-RA (Dhc36C), mRNA 
NM_057643.2  Ryanodine receptor 44F CG10844-RA, transcript variant A (Rya-r44F), mRNA 
NM_057644.2  Ryanodine receptor 44F CG10844-RB, transcript variant B (Rya-r44F), mRNA 
NM_057646.2  Ryanodine receptor 44F CG10844-RD, transcript variant D (Rya-r44F), mRNA 
NM_057645.2  Ryanodine receptor 44F CG10844-RC, transcript variant C (Rya-r44F), mRNA 
NM_170624.1  CG17034-RB, transcript variant B (CG17034), mRNA 
100  357  NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
100  357  NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 
NM_057894.3  defective proventriculus CG5799-RA, transcript variant A (dve), mRNA 
NM_057893.3  defective proventriculus CG5799-RB, transcript variant B (dve), mRNA 
NM_140744.1  TORC CG6064-RA (TORC), mRNA 
NM_079086.2  quaking related 58E-2 CG5821-RA (qkr58E-2), mRNA 
NM_138188.1  CG1231-RA (CG1231), mRNA 
NM_080318.2  Syntaxin 4 CG2715-RA (Syx4), mRNA 
NM_137209.2  CG8214-RA (CG8214), mRNA 
NM_143323.3  CG12880-RA (CG12880), mRNA 
NM_176066.2  CG9331-RC, transcript variant C (CG9331), mRNA 
NM_165345.1  CG9331-RA, transcript variant A (CG9331), mRNA 
NM_136218.2  CG9331-RB, transcript variant B (CG9331), mRNA 
NM_169357.1  Mediator complex subunit 7 CG31390-RA (MED7), mRNA 
NM_206015.1  CG9331-RE, transcript variant E (CG9331), mRNA 
NM_176067.1  CG9331-RD, transcript variant D (CG9331), mRNA 
NM_167069.1  CG15891-RA, transcript variant A (CG15891), mRNA 
NM_001031869.1  CG15892-RB, transcript variant B (CG15892), mRNA 
NM_135232.1  CG17375-RA (CG17375), mRNA 
NM_079472.2  Acetyl Coenzyme A synthase CG9390-RB, transcript variant B (AcCoAS), mRNA 
NM_168894.1  Acetyl Coenzyme A synthase CG9390-RA, transcript variant A (AcCoAS), mRNA 
NM_001014599.1  Acetyl Coenzyme A synthase CG9390-RC, transcript variant C (AcCoAS), mRNA 
NM_167424.1  CG32594-RC, transcript variant C (CG32594), mRNA 
NM_132762.3  CG32594-RB, transcript variant B (CG32594), mRNA 
NM_132959.2  CG8949-RA (CG8949), mRNA 
NM_142684.2  CG5745-RA (CG5745), mRNA 
NM_169851.1  CG31475-RA (CG31475), mRNA 
NM_139687.2  CG10671-RA, transcript variant A (CG10671), mRNA 
NM_168110.2  CG10671-RB, transcript variant B (CG10671), mRNA 
NM_167287.1  Cyp4g15 CG11715-RB, transcript variant B (Cyp4g15), mRNA 
100  482  NM_166189.1  CG30463-RB, transcript variant B (CG30463), mRNA 
100  482  NM_166188.1  CG30463-RA, transcript variant A (CG30463), mRNA 
0.41  NM_142577.1  ire-1 CG4583-RA (ire-1), mRNA 
0.2  NM_167735.1  CG32521-RB, transcript variant B (CG32521), mRNA 
0.2  NM_167734.1  CG32521-RA, transcript variant A (CG32521), mRNA 
NM_166341.1  CG30127-RA (CG30127), mRNA 
NM_141759.1  CG14686-RA (CG14686), mRNA 
NM_138229.1  CG13908-RA (CG13908), mRNA 
11  NM_206506.1  osa CG7467-RC, transcript variant C (osa), mRNA 
11  NM_079668.2  osa CG7467-RB, transcript variant B (osa), mRNA 
11  NM_169775.1  osa CG7467-RA, transcript variant A (osa), mRNA 
NM_169278.2  CG9356-RB, transcript variant B (CG9356), mRNA 
NM_141632.1  CG9356-RA, transcript variant A (CG9356), mRNA 
12  NM_134497.1  CG14223-RA (CG14223), mRNA 
NM_141137.1  CG11426-RA (CG11426), mRNA 
NM_080085.2  optic ganglion reduced CG3039-RA, transcript variant A (ogre), mRNA 
NM_079463.2  knirps CG4717-RA (kni), mRNA 
NM_135229.2  CG17378-RA, transcript variant A (CG17378), mRNA 
NM_167620.2  CG32547-RA (CG32547), mRNA 
NM_165483.1  Tyrosine decarboxylase 2 CG30446-RA (Tdc2), mRNA 
NM_143086.2  distal antenna-related CG13651-RA (danr), mRNA 
NM_168680.1  zetaCOP CG3948-RB, transcript variant B (zetaCOP), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.