National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8376R-1 
 Symbol ap  Full Name apterous 
 CG No CG8376  Old CG No CG8376 
 Synonyms S-2a, CG8376, LIM, blt, Xa, trw, ap, Ap 
 Accession No (Link to NCBI) NM_165445.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Shimada N, Inami S, Sato S, Kitamoto T, Sakai T.
Modulation of light-driven arousal by LIM-homeodomain transcription factor Apterous in large PDF-positive lateral neurons of the Drosophila brain.
Sci Rep (2016) 6 37255 [ PubMed ID = 27853240 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Natori K, Tajiri R, Furukawa S, Kojima T.
Progressive tarsal patterning in the Drosophila by temporally dynamic regulation of transcription factor genes.
Dev. Biol. (2012) 361(2) 450-62 [ PubMed ID = 22079694 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATAACGCGCAACCTCGACGAC 
 Primer Seq. 3'
aatctagaggtaccGGAACAATGCTCCGACTAGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATAACGCGCA ACCTCGACGA CCTGCTCCGG CTGCGGACGT CAGATACAGG ATCGCTTCTA 
0061 CCTCTCCGCT GTGGAAAAAC GGTGGCATGC AAGTTGCCTA CAGTGCTACG CCTGTCGGCA 
0121 GCCGCTGGAA CGGGAATCCT CATGCTACTC ACGTGACGGC AACATTTATT GCAAAAACGA 
0181 TTATTATAGT TTTTTTGGTA CTCGCCGATG CTCGCGCTGC CTGGCCTCCA TCAGCTCCAA 
0241 CGAGCTGGTC ATGCGCGCCC GAAATCTTGT TTTTCACGTC AACTGCTTCT GCTGCACTGT 
0301 CTGCCACACG CCACTGACAA AGGGAGACCA GTACGGCATC ATCGACGCCC TCATCTACTG 
0361 CAGGACCCAC TACAGCATAG CCAGGGAGGG GGATACCGCC TCATCCAGTA TGAGCGCCAC 
0421 CTACCCGTAC AGCGCCCAGT TCGGCTCACC CCACAACGAC TCCTCGAGCC CGCACTCGGA 
0481 CCCTAGTCGG AGCATTGTTC C 
 in silico PCR Fragment
0001 ATAACGCGCA ACCTCGACGA -CTGCTCCGG CTGCGGACGT CAGATACAGG ATCGCTTCTA 
0061 CCTCTCCGCT GTGGAAAAAC GGTGGCATGC AAGTTGCCTA CAGTGCTACG CCTGTCGGCA 
0121 GCCGCTGGAA CGGGAATCCT CATGCTACTC ACGTGACGGC AACATTTATT GCAAAAACGA 
0181 TTATTATAGT TTTTTTGGTA CTCGCCGATG CTCGCGCTGC CTGGCCTCCA TCAGCTCCAA 
0241 CGAGCTGGTC ATGCGCGCCA GAAATCTTGT TTTTCACGTC AACTGCTTCT GCTGCACTGT 
0301 CTGCCACACG CCACTGACAA AGGGAGACCA GTACGGCATC ATCGACGCCC TCATCTACTG 
0361 CAGGACCCAC TACAGCATAG CCAGGGAGGG GGATACCGCC TCATCCAGTA TGAGCGCCAC 
0421 CTACCCGTAC AGCGCCCAGT TCGGCTCACC CCACAACGAC TCCTCGAGCC CGCACTCGGA 
0481 CCCTAGTCGG AGCATTGTTC C 
 Assemble Data

8376R-1.IR_full       1   ATAACGCGCAACCTCGACGACCTGCTCCGGCTGCGGACGTCAGATACAGGATCGCTTCTA 60
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     1   ATAACGCGCAACCTCGACGA-CTGCTCCGGCTGCGGACGTCAGATACAGGATCGCTTCTA 60


8376R-1.IR_full       61  CCTCTCCGCTGTGGAAAAACGGTGGCATGCAAGTTGCCTACAGTGCTACGCCTGTCGGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     61  CCTCTCCGCTGTGGAAAAACGGTGGCATGCAAGTTGCCTACAGTGCTACGCCTGTCGGCA 120


8376R-1.IR_full       121 GCCGCTGGAACGGGAATCCTCATGCTACTCACGTGACGGCAACATTTATTGCAAAAACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     121 GCCGCTGGAACGGGAATCCTCATGCTACTCACGTGACGGCAACATTTATTGCAAAAACGA 180


8376R-1.IR_full       181 TTATTATAGTTTTTTTGGTACTCGCCGATGCTCGCGCTGCCTGGCCTCCATCAGCTCCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     181 TTATTATAGTTTTTTTGGTACTCGCCGATGCTCGCGCTGCCTGGCCTCCATCAGCTCCAA 240


8376R-1.IR_full       241 CGAGCTGGTCATGCGCGCCCGAAATCTTGTTTTTCACGTCAACTGCTTCTGCTGCACTGT 300
                          ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     241 CGAGCTGGTCATGCGCGCCAGAAATCTTGTTTTTCACGTCAACTGCTTCTGCTGCACTGT 300


8376R-1.IR_full       301 CTGCCACACGCCACTGACAAAGGGAGACCAGTACGGCATCATCGACGCCCTCATCTACTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     301 CTGCCACACGCCACTGACAAAGGGAGACCAGTACGGCATCATCGACGCCCTCATCTACTG 360


8376R-1.IR_full       361 CAGGACCCACTACAGCATAGCCAGGGAGGGGGATACCGCCTCATCCAGTATGAGCGCCAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     361 CAGGACCCACTACAGCATAGCCAGGGAGGGGGATACCGCCTCATCCAGTATGAGCGCCAC 420


8376R-1.IR_full       421 CTACCCGTACAGCGCCCAGTTCGGCTCACCCCACAACGACTCCTCGAGCCCGCACTCGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8376R-1.in silico     421 CTACCCGTACAGCGCCCAGTTCGGCTCACCCCACAACGACTCCTCGAGCCCGCACTCGGA 480


8376R-1.IR_full       481 CCCTAGTCGGAGCATTGTTCC 501
                          |||||||||||||||||||||
8376R-1.in silico     481 CCCTAGTCGGAGCATTGTTCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165445.2  CG8376-RA, transcript variant A (ap), mRNA 
60.99   294  NM_078897.3  CG8376-RB, transcript variant B (ap), mRNA 
0   NM_079178.2  CG1921-RB, transcript variant B (sty), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_168031.1  CG1921-RC, transcript variant C (sty), mRNA 
0   NM_133012.2  CG32560-RA (CG32560), mRNA 
0   NM_167676.1  CG12529-RB, transcript variant B (Zw), mRNA 
0   NM_078687.1  CG12529-RA, transcript variant A (Zw), mRNA 
0   NM_143101.1  CG11854-RA (CG11854), mRNA 
0   NM_080073.2  CG17697-RA, transcript variant A (fz), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_142931.3  CG10192-RA (CG10192), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
0   NM_137931.1  CG13541-RA (CG13541), mRNA 
0   NM_167307.1  CG4147-RC, transcript variant C (Hsc70-3), mRNA 
0   NM_167306.1  CG4147-RA, transcript variant A (Hsc70-3), mRNA 
0   NM_167308.1  CG4147-RD, transcript variant D (Hsc70-3), mRNA 
0   NM_078577.2  CG4147-RB, transcript variant B (Hsc70-3), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_134507.1  CG14234-RA (CG14234), mRNA 
0   NM_079749.4  CG5405-RA, transcript variant A (KrT95D), mRNA 
0   NM_170108.2  CG5405-RB, transcript variant B (KrT95D), mRNA 
0   NM_170110.2  CG5405-RC, transcript variant C (KrT95D), mRNA 
0   NM_137402.2  CG4966-RA, transcript variant A (CG4966), mRNA 
0   29  NM_001015110.1  CG40323-PB.3 (CG40323), mRNA 
0   NM_141408.3  CG1137-RA (CG1137), mRNA 
0   NM_142646.1  CG5483-RA (CG5483), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.