National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8331R-3 
 Symbol CG8331  Full Name CG8331 
 CG No CG8331  Old CG No CG8331 
 Synonyms CT24597, CG8331 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yalçın B, Zhao L, Stofanko M, O'Sullivan NC, Kang ZH, Roost A, Thomas MR, Zaessinger S, Blard O, Patto AL, Sohail A, Baena V, Terasaki M, O'Kane CJ.
Modeling of axonal endoplasmic reticulum network by spastic paraplegia proteins.
Elife (2017) 6 [ PubMed ID = 28742022 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCACTCAGGTGAAGCAG 
 Primer Seq. 3'
aatctagaggtaccCCATCATCGATGATCCTGTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCACTC AGGTGAAGCA GTTCTTAAAC GGCTACAAGG ATGACGTGAG CAAATCGCTN 
0061 NNCGATGCTT CCAAGCCGTG GACCAAAGTC TTCGATACCG TGGAGGAGAA GACCGGCGTG 
0121 GACCGGGTCA ATATTTTCGT GGGTGCTGTT GGTCTGTGCG CCATCTACCT GATCTTTGGC 
0181 TGGGGCGCCC AACTACTGTG CAACATCATT GGGGTTCTGT ACCCTGCATA TATTTCCATC 
0241 CATGCCATCG AGTCCAGCAC AAAGCAGGAC GACACCAAGT GGCTGATCTA CTGGGTCACG 
0301 TTTGGCATCT TCACCGTGAT TGAATTCTTT TCGAGTCTGC TAACTTCGGT GATTCCCTTT 
0361 TACTGGCTGC TGAAGTGTGC TTTCCTCATC TGGTGCATGC TGCCCACGGA ACAGAATGGT 
0421 TCTACCATCA TCTACAACAA GCTGGTGCGA CCCTACTTCC TGAAACATCA CGAATCCGTT 
0481 GACAGGATCA TCGATGATGN  
 in silico PCR Fragment
0001 ATGGCCACTC AGGTGAAGCA GTTCTTAAAC GGCTACAAGG ATGACGTGAG CAAATCGCTG 
0061 CGCGATGCTT CCAAGCCGTG GACCAAAGTC TTCGATACCG TGGAGGAGAA GACCGGCGTG 
0121 GACCGGGTCA ATATTTTCGT GGGTGCTGTT GGTCTGTGCG CCATCTACCT GATCTTTGGC 
0181 TGGGGCGCCC AACTACTGTG CAACATCATT GGGGTTCTGT ACCCTGCATA TATTTCCATC 
0241 CATGCCATCG AGTCCAGCAC AAAGCAGGAC GACACCAAGT GGCTGATCTA CTGGGTCACG 
0301 TTTGGAATCT TCACCGTGAT TGAATTCTTT TCGAGTCTGC TAACTTCGGT GATTCCCTTT 
0361 TACTGGCTGC TGAAGTGTGC TTTCCTCATC TGGTGCATGC TGCCCACGGA ACAGAATGGT 
0421 TCTACCATCA TCTACAACAA GCTGGTGCGA CCCTACTTCC TGAAACATCA CGAATCCGTT 
0481 GACAGGATCA TCGATGATGG  
 Assemble Data

8331R-3.IR full       1   ATGGCCACTCAGGTGAAGCAGTTCTTAAACGGCTACAAGGATGACGTGAGCAAATCGCTN 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
8331R-3.in silico     1   ATGGCCACTCAGGTGAAGCAGTTCTTAAACGGCTACAAGGATGACGTGAGCAAATCGCTG 60


8331R-3.IR full        N61  CGATGCTTCCAAGCCGTGGACCAAAGTCTTCGATACCGTGGAGGAGAAGACCGGCGTG 118
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8331R-3.in silico      C61  CGATGCTTCCAAGCCGTGGACCAAAGTCTTCGATACCGTGGAGGAGAAGACCGGCGTG 118


8331R-3.IR full       121 GACCGGGTCAATATTTTCGTGGGTGCTGTTGGTCTGTGCGCCATCTACCTGATCTTTGGC 178
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8331R-3.in silico     121 GACCGGGTCAATATTTTCGTGGGTGCTGTTGGTCTGTGCGCCATCTACCTGATCTTTGGC 178


8331R-3.IR full       181 TGGGGCGCCCAACTACTGTGCAACATCATTGGGGTTCTGTACCCTGCATATATTTCCATC 238
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8331R-3.in silico     181 TGGGGCGCCCAACTACTGTGCAACATCATTGGGGTTCTGTACCCTGCATATATTTCCATC 238


8331R-3.IR full       241 CATGCCATCGAGTCCAGCACAAAGCAGGACGACACCAAGTGGCTGATCTACTGGGTCACG 298
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8331R-3.in silico     241 CATGCCATCGAGTCCAGCACAAAGCAGGACGACACCAAGTGGCTGATCTACTGGGTCACG 298


8331R-3.IR full       301 TTTGGCATCTTCACCGTGATTGAATTCTTTTCGAGTCTGCTAACTTCGGTGATTCCCTTT 358
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
8331R-3.in silico     301 TTTGGAATCTTCACCGTGATTGAATTCTTTTCGAGTCTGCTAACTTCGGTGATTCCCTTT 358


8331R-3.IR full       361 TACTGGCTGCTGAAGTGTGCTTTCCTCATCTGGTGCATGCTGCCCACGGAACAGAATGGT 418
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8331R-3.in silico     361 TACTGGCTGCTGAAGTGTGCTTTCCTCATCTGGTGCATGCTGCCCACGGAACAGAATGGT 418


8331R-3.IR full       421 TCTACCATCATCTACAACAAGCTGGTGCGACCCTACTTCCTGAAACATCACGAATCCGTT 478
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8331R-3.in silico     421 TCTACCATCATCTACAACAAGCTGGTGCGACCCTACTTCCTGAAACATCACGAATCCGTT 478


8331R-3.IR full       481 GACAGGATCATCGATGATGN 498
                          ||||||||||||||||||| 
8331R-3.in silico     481 GACAGGATCATCGATGATGG 498

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.