National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8308R-3 
 Symbol alphaTub67C  Full Name alpha-Tubulin at 67C 
 CG No CG8308  Old CG No CG8308 
 Synonyms alpha-tubulin, alpha-Tub, alphaTUB, mum-tub67C, alpha-tub67C, CG8308, ALPHA 67C, D.m.ALPHA-67C, alphaTub[67C], alphatub67C, alpha4, aTub67C, alpha4Tub67C, alpha4-t, Tom, T, 4t, Fs(3)Tomaj, alpha67C, DTA2, alphaTub67C, Fs(3)Tom, Fs(3)Sz22, alphaTub4, alpha4t, alpha-Tub67C, alphaTub, alphatub, Tub 
 Accession No (Link to NCBI) NM_079285.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCGGCAATGCCTGCTGGGAG 
 Primer Seq. 3'
aatctagaggtaccACGGCAAAGTCCAGCTTGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCGGCAATG CCTGCTGGGA GCTGTACCTG CTGGAGCACG GCATCaACCT GGACGGCAGC 
0061 CTGAAGACCA AGGAGGAGCT GACGGCCAGC GGGAGCAGTG CCAGTGTGGG TCACGACACC 
0121 TCGGCCAACG ATGCTAGGAC CTTCTTCACG GAGACCGGCA ATGGAAAACA AGTGCCACGC 
0181 TCGATTTTCG TCGATCTGGA ACCGACGGTC ATCGATGATG TTCGGAATGG CTGCATGAGG 
0241 GAGCTCTATC ATCCGGAGCA ACTGATTTCT GGAAAGGAAG ATGCGGCCAA TAACTATGCC 
0301 CGAGGTCGTT ACTCCATCTG GCAAGGAGGT GATCGATAGG GTGAcCTCAC GGCTGCAGAA 
0361 GATCGCAGAG CAGTGTGACA GCTTGCAGGG ATTCCTCCAT CTTCCACTCG CTGGGCGGTG 
0421 GTACTGGTTC gGGATTCACA TCCCTGTTGG TGGAGCGCTT GTCCACCGAT TACAGCAAGA 
0481 AGTGCAAGCT GGACTTTGCC GT 
 in silico PCR Fragment
0001 ATCGGCAATG CCTGCTGGGA GCTGTACCTG CTGGAGCACG GCATCAACCT GGACGGCAGC 
0061 CTGAAGACCA AGGAGGAGCT GACGGCCAGC GGGAGCAGTG CCAGTGTGGG TCACGACACC 
0121 TCGGCCAACG ATGCTAGGAC CTTCTTCACG GAGACCGGCA ATGGAAAACA AGTGCCACGC 
0181 TCGATTTTCG TCGATCTGGA ACCGACGGTC ATCGATGATG TTCGGAATGG CTGCATGAGG 
0241 GAGCTCTATC ATCCGGAGCA ACTGATTTCT GGAAAGGAAG ATGCGGCCAA TAACTATGCC 
0301 CGAGGTCGTT ACTCCAT-TG GCAAGGAGGT GATCGATAGG GTGACCTCAC GGCTGCAGAA 
0361 GATCGCAGAG CAGTGTGACA GCTTGCAGGG ATTCCT-CAT CTTCCACTCG CTGGGCGGTG 
0421 GTACTGGTTC GGGATTCACA TCCCTGTTGG TGGAGCGCTT GTCCACCGAT TACAGCAAGA 
0481 AGTGCAAGCT GGACTTTGCC GT 
 Assemble Data

8308R-3.IR_full       1   ATCGGCAATGCCTGCTGGGAGCTGTACCTGCTGGAGCACGGCATCAACCTGGACGGCAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8308R-3.in silico     1   ATCGGCAATGCCTGCTGGGAGCTGTACCTGCTGGAGCACGGCATCAACCTGGACGGCAGC 60


8308R-3.IR_full       61  CTGAAGACCAAGGAGGAGCTGACGGCCAGCGGGAGCAGTGCCAGTGTGGGTCACGACACC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8308R-3.in silico     61  CTGAAGACCAAGGAGGAGCTGACGGCCAGCGGGAGCAGTGCCAGTGTGGGTCACGACACC 120


8308R-3.IR_full       121 TCGGCCAACGATGCTAGGACCTTCTTCACGGAGACCGGCAATGGAAAACAAGTGCCACGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8308R-3.in silico     121 TCGGCCAACGATGCTAGGACCTTCTTCACGGAGACCGGCAATGGAAAACAAGTGCCACGC 180


8308R-3.IR_full       181 TCGATTTTCGTCGATCTGGAACCGACGGTCATCGATGATGTTCGGAATGGCTGCATGAGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8308R-3.in silico     181 TCGATTTTCGTCGATCTGGAACCGACGGTCATCGATGATGTTCGGAATGGCTGCATGAGG 240


8308R-3.IR_full       241 GAGCTCTATCATCCGGAGCAACTGATTTCTGGAAAGGAAGATGCGGCCAATAACTATGCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8308R-3.in silico     241 GAGCTCTATCATCCGGAGCAACTGATTTCTGGAAAGGAAGATGCGGCCAATAACTATGCC 300


8308R-3.IR_full       301 CGAGGTCGTTACTCCATCTGGCAAGGAGGTGATCGATAGGGTGACCTCACGGCTGCAGAA 360
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8308R-3.in silico     301 CGAGGTCGTTACTCCAT-TGGCAAGGAGGTGATCGATAGGGTGACCTCACGGCTGCAGAA 360


8308R-3.IR_full       361 GATCGCAGAGCAGTGTGACAGCTTGCAGGGATTCCTCCATCTTCCACTCGCTGGGCGGTG 420
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
8308R-3.in silico     361 GATCGCAGAGCAGTGTGACAGCTTGCAGGGATTCCT-CATCTTCCACTCGCTGGGCGGTG 420


8308R-3.IR_full       421 GTACTGGTTCGGGATTCACATCCCTGTTGGTGGAGCGCTTGTCCACCGATTACAGCAAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8308R-3.in silico     421 GTACTGGTTCGGGATTCACATCCCTGTTGGTGGAGCGCTTGTCCACCGATTACAGCAAGA 480


8308R-3.IR_full       481 AGTGCAAGCTGGACTTTGCCGT 502
                          ||||||||||||||||||||||
8308R-3.in silico     481 AGTGCAAGCTGGACTTTGCCGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079285.2  CG8308-RA (alphaTub67C), mRNA 
0.41   28  42  NM_079573.3  CG9476-RA (alphaTub85E), mRNA 
0.41   NM_132413.1  CG15295-RA (CG15295), mRNA 
0.2   NM_078772.2  CG13772-RA (neuroligin), mRNA 
0   15  32  37  NM_169189.1  CG2512-RB, transcript variant B (alphaTub84D), mRNA 
0   15  32  37  NM_079540.4  CG2512-RA, transcript variant A (alphaTub84D), mRNA 
0   11  31  38  NM_057424.3  CG1913-RA (alphaTub84B), mRNA 
0   NM_176164.1  CG33182-RA (CG33182), mRNA 
0   NM_135787.2  CG9414-RA (Rep4), mRNA 
0   NM_001032010.1  CG6783-RA, transcript variant A (CG6783), mRNA 
0   NM_164929.1  CG6206-RB, transcript variant B (CG6206), mRNA 
0   NM_135564.3  CG6206-RA, transcript variant A (CG6206), mRNA 
0   NM_001032009.1  CG6783-RB, transcript variant B (CG6783), mRNA 
0   NM_001032008.1  CG6783-RC, transcript variant C (CG6783), mRNA 
0   NM_001032005.1  CG6782-RD, transcript variant D (CG6782), mRNA 
0   NM_080218.2  CG8137-RA (Spn2), mRNA 
0   NM_135917.2  CG18480-RA (CG18480), mRNA 
0   NM_135608.1  CG6724-RA (CG6724), mRNA 
0   NM_001032264.1  CG4844-RB, transcript variant B (CG4844), mRNA 
0   NM_001032266.1  CG18431-RA, transcript variant A (CG18431), mRNA 
0   NM_001032265.1  CG4844-RA, transcript variant A (CG4844), mRNA 
0   NM_136077.1  CG10623-RA (CG10623), mRNA 
0   NM_139720.2  CG5150-RA (CG5150), mRNA 
0   NM_132615.1  CG4395-RA (CG4395), mRNA 
0   NM_057378.2  CG4200-RA (sl), mRNA 
0   NM_170236.1  CG31096-RA (Lgr3), mRNA 
0   NM_168246.1  CG8042-RB, transcript variant B (CG8042), mRNA 
0   NM_139908.2  CG8042-RA, transcript variant A (CG8042), mRNA 
0   NM_139477.1  CG14949-RA (CG14949), mRNA 
0   NM_167996.1  CG32278-RA (CG32278), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
++ 
VM
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.