National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8293R-2 
 Symbol Iap2  Full Name Inhibitor of apoptosis 2 
 CG No CG8293  Old CG No CG8293 
 Synonyms CG8293, DIAP2, DIAPII, diap2, Diap2, DIAP-2, DIAP, dIAP2, IAP, dIAP, DIHA, D-IAP2, dILP, D-iap2, Ilp, Diha, Diap, Iap2 
 Accession No (Link to NCBI) NM_057779.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kleino A, Valanne S, Ulvila J, Kallio J, Myllymäki H, Enwald H, Stöven S, Poidevin M, Ueda R, Hultmark D, Lemaitre B, Rämet M.
Inhibitor of apoptosis 2 and TAK1-binding protein are components of the Drosophila Imd pathway.
EMBO J. (2005) 24(19) 3423-34 [ PubMed ID = 16163390 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGCCCCTGAATGCCCCAGTTTCCGCGGAGGATCTGGTCGCCAATGGTTTCTTTGCCAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGGAAACTGGCTGGAGGCCGAGTGCCATTTCTGCCACGTGCGCATCGACCGCTGGGAATA 120

                          |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| silico     121 CGGCGATCAAGTGGCGGAGCGCCA-TCGCCGCTCCTCGCCCATCTGCTCCATGGTTCTGG 180

                          ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     181 CTCCCAATCACTGCGGCAATGTTCCCAGGAGCCAGGAGAGCGACAACGAGGGAAACAGCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TAGTGGACAGCCCGGAGTCCTGCTCTTGTCCCGATCTCTTGTTGGAGGCCAATCGCTTGG 300

                          ||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| silico     301 TAACTTTCAAGGACTGGCCGAATCCCAACAT-CACGCCGCAGGCTCTGGCAAAGGCAGGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTCTACTACCTGAACCGTCTGGATCACGTGAAGTGTGTTTGGTGCAACGGAGTGATTGCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGTGGGAGAAGAACGACAATGCCTTTGAAGAGCACAAGCGCTTTTTTCCCCAATGTCCT 480

8293R-2.IR_full       481 CGTGTGCAAATGGGCCCCCTTA 502
                          |||||||||||||||||||||| silico     481 CGTGTGCAAATGGGCCCCCTTA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176182.1  CG8293-RB, transcript variant B (Iap2), mRNA 
100   482  NM_057779.3  CG8293-RA, transcript variant A (Iap2), mRNA 
0   NM_057575.2  CG8704-RA (dpn), mRNA 
0   NM_164653.1  CG31646-RA (CG31646), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   10  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   10  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0   NM_166270.1  CG5738-RB, transcript variant B (lolal), mRNA 
0   NM_080039.2  CG5738-RA, transcript variant A (lolal), mRNA 
0   NM_166271.1  CG5738-RC, transcript variant C (lolal), mRNA 
0   NM_166272.1  CG5738-RD, transcript variant D (lolal), mRNA 
0   NM_168777.1  CG6874-RB, transcript variant B (l(3)neo26), mRNA 
0   NM_140804.2  CG6874-RA, transcript variant A (l(3)neo26), mRNA 
0   NM_142863.1  CG6726-RA, transcript variant A (CG6726), mRNA 
0   NM_170048.1  CG6726-RB, transcript variant B (CG6726), mRNA 
0   NM_078562.2  CG1639-RA (l(1)10Bb), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_143344.2  CG5520-RA (Gp93), mRNA 
0   NR_001327.1  CG5520-RA (Gp93), mRNA, mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_057944.3  CG12249-RB, transcript variant B (mira), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_057943.3  CG12249-RA, transcript variant A (mira), mRNA 
0   NM_144348.2  CG12135-RA (c12.1), mRNA 
0   NM_079446.2  CG8637-RA (trc), mRNA 
0   NM_132249.1  CG1440-RA (CG1440), mRNA 
0   NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.