National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8293R-1 
 Symbol Iap2  Full Name Inhibitor of apoptosis 2 
 CG No CG8293  Old CG No CG8293 
 Synonyms CG8293, DIAP2, DIAPII, diap2, Diap2, DIAP-2, DIAP, dIAP2, IAP, dIAP, DIHA, D-IAP2, dILP, D-iap2, Ilp, Diha, Diap, Iap2 
 Accession No (Link to NCBI) NM_057779.3 
 Inserted Chr. lll 
 Insertional Mutation  homo rough eye 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kleino A, Valanne S, Ulvila J, Kallio J, Myllymäki H, Enwald H, Stöven S, Poidevin M, Ueda R, Hultmark D, Lemaitre B, Rämet M.
Inhibitor of apoptosis 2 and TAK1-binding protein are components of the Drosophila Imd pathway.
EMBO J. (2005) 24(19) 3423-34 [ PubMed ID = 16163390 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCCCTGAATGCCCCAGT 
 Primer Seq. 3'
aatctagaggtaccTAAGGGGGCCCATTTGCACAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCCCTG AATGCCCCAG TTTCCGCGGA GGATCTGGTC GCCAATGGTT TCTTTGCCAC 
0061 GGGAAACTGG CTGGAGGCCG AGTGCCATTT CTGCCACGTG CGCATCGACC GCTGGGAATA 
0121 CGGCGATCAA GTGGCGGAGC GCCANTCGAC GCTCCTCGCC CATCTGCTCC ATGGTTCTGG 
0181 CTCCCAATCA CTGCGGCAAT GTTCCCAGGA GCCAGGAGAG CGACAACAAG GGAAACAGCG 
0241 TAGTGGACAG CCCGGAGTCC TGCTCTTGTC CCGATCTCTT GTTGGAGGCC AATCGCTTGG 
0301 TAACTTTCAA GGACTGGCCG AATCCCAACA TNCNCGcCGC AGGCTCTGGC AAAGGCAGGT 
0361 TTCTACTACC TGAACCGTCT GGATCACGTG AAGTGTGTTT GGTGCAACGG AGTGATTGCC 
0421 AAGTGGGAGA AGAACGACAA TGCCTTTGAA GAGCACAAGC GCTTTTTTCC CCAATGTCCT 
0481 CGTGTGCAAA TGGGCCCCCT TA 
 in silico PCR Fragment
0001 ATGGCCCCTG AATGCCCCAG TTTCCGCGGA GGATCTGGTC GCCAATGGTT TCTTTGCCAC 
0061 GGGAAACTGG CTGGAGGCCG AGTGCCATTT CTGCCACGTG CGCATCGACC GCTGGGAATA 
0121 CGGCGATCAA GTGGCGGAGC GCCA-TCGCC GCTCCTCGCC CATCTGCTCC ATGGTTCTGG 
0181 CTCCCAATCA CTGCGGCAAT GTTCCCAGGA GCCAGGAGAG CGACAACGAG GGAAACAGCG 
0241 TAGTGGACAG CCCGGAGTCC TGCTCTTGTC CCGATCTCTT GTTGGAGGCC AATCGCTTGG 
0301 TAACTTTCAA GGACTGGCCG AATCCCAACA T-CACGCCGC AGGCTCTGGC AAAGGCAGGT 
0361 TTCTACTACC TGAACCGTCT GGATCACGTG AAGTGTGTTT GGTGCAACGG AGTGATTGCC 
0421 AAGTGGGAGA AGAACGACAA TGCCTTTGAA GAGCACAAGC GCTTTTTTCC CCAATGTCCT 
0481 CGTGTGCAAA TGGGCCCCCT TA 
 Assemble Data

8293R-1.IR_full       1   ATGGCCCCTGAATGCCCCAGTTTCCGCGGAGGATCTGGTCGCCAATGGTTTCTTTGCCAC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8293R-1.in silico     1   ATGGCCCCTGAATGCCCCAGTTTCCGCGGAGGATCTGGTCGCCAATGGTTTCTTTGCCAC 60


8293R-1.IR_full       61  GGGAAACTGGCTGGAGGCCGAGTGCCATTTCTGCCACGTGCGCATCGACCGCTGGGAATA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8293R-1.in silico     61  GGGAAACTGGCTGGAGGCCGAGTGCCATTTCTGCCACGTGCGCATCGACCGCTGGGAATA 120


8293R-1.IR_full       121 CGGCGATCAAGTGGCGGAGCGCCANTCGACGCTCCTCGCCCATCTGCTCCATGGTTCTGG 180
                          |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||
8293R-1.in silico     121 CGGCGATCAAGTGGCGGAGCGCCA-TCGCCGCTCCTCGCCCATCTGCTCCATGGTTCTGG 180


8293R-1.IR_full       181 CTCCCAATCACTGCGGCAATGTTCCCAGGAGCCAGGAGAGCGACAACAAGGGAAACAGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
8293R-1.in silico     181 CTCCCAATCACTGCGGCAATGTTCCCAGGAGCCAGGAGAGCGACAACGAGGGAAACAGCG 240


8293R-1.IR_full       241 TAGTGGACAGCCCGGAGTCCTGCTCTTGTCCCGATCTCTTGTTGGAGGCCAATCGCTTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8293R-1.in silico     241 TAGTGGACAGCCCGGAGTCCTGCTCTTGTCCCGATCTCTTGTTGGAGGCCAATCGCTTGG 300


8293R-1.IR_full       301 TAACTTTCAAGGACTGGCCGAATCCCAACATNCNCGCCGCAGGCTCTGGCAAAGGCAGGT 360
                          ||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||
8293R-1.in silico     301 TAACTTTCAAGGACTGGCCGAATCCCAACAT-CACGCCGCAGGCTCTGGCAAAGGCAGGT 360


8293R-1.IR_full       361 TTCTACTACCTGAACCGTCTGGATCACGTGAAGTGTGTTTGGTGCAACGGAGTGATTGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8293R-1.in silico     361 TTCTACTACCTGAACCGTCTGGATCACGTGAAGTGTGTTTGGTGCAACGGAGTGATTGCC 420


8293R-1.IR_full       421 AAGTGGGAGAAGAACGACAATGCCTTTGAAGAGCACAAGCGCTTTTTTCCCCAATGTCCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8293R-1.in silico     421 AAGTGGGAGAAGAACGACAATGCCTTTGAAGAGCACAAGCGCTTTTTTCCCCAATGTCCT 480


8293R-1.IR_full       481 CGTGTGCAAATGGGCCCCCTTA 502
                          ||||||||||||||||||||||
8293R-1.in silico     481 CGTGTGCAAATGGGCCCCCTTA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_176182.1  CG8293-RB, transcript variant B (Iap2), mRNA 
100   482  NM_057779.3  CG8293-RA, transcript variant A (Iap2), mRNA 
0   NM_057575.2  CG8704-RA (dpn), mRNA 
0   NM_164653.1  CG31646-RA (CG31646), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 
0   10  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
0   10  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
0   NM_176244.1  CG9696-RE, transcript variant E (dom), mRNA 
0   NM_166270.1  CG5738-RB, transcript variant B (lolal), mRNA 
0   NM_080039.2  CG5738-RA, transcript variant A (lolal), mRNA 
0   NM_166271.1  CG5738-RC, transcript variant C (lolal), mRNA 
0   NM_166272.1  CG5738-RD, transcript variant D (lolal), mRNA 
0   NM_168777.1  CG6874-RB, transcript variant B (l(3)neo26), mRNA 
0   NM_140804.2  CG6874-RA, transcript variant A (l(3)neo26), mRNA 
0   NM_142863.1  CG6726-RA, transcript variant A (CG6726), mRNA 
0   NM_170048.1  CG6726-RB, transcript variant B (CG6726), mRNA 
0   NM_078562.2  CG1639-RA (l(1)10Bb), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_143344.2  CG5520-RA (Gp93), mRNA 
0   NR_001327.1  CG5520-RA (Gp93), mRNA, mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_057944.3  CG12249-RB, transcript variant B (mira), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_057943.3  CG12249-RA, transcript variant A (mira), mRNA 
0   NM_144348.2  CG12135-RA (c12.1), mRNA 
0   NM_079446.2  CG8637-RA (trc), mRNA 
0   NM_132249.1  CG1440-RA (CG1440), mRNA 
0   NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   NM_164567.1  CG3399-RB, transcript variant B (capu), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.