National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8276R-3 
 Symbol bin3  Full Name bicoid-interacting protein 3 
 CG No CG8276  Old CG No CG8276 
 Synonyms CG8276, Bin3, bin3 
 Accession No (Link to NCBI) NM_165468.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dourlen P, Fernandez-Gomez FJ, Dupont C, Grenier-Boley B, Bellenguez C, Obriot H, Caillierez R, Sottejeau Y, Chapuis J, Bretteville A, Abdelfettah F, Delay C, Malmanche N, Soininen H, Hiltunen M, Galas MC, Amouyel P, Sergeant N, Buée L, Lambert JC, Dermaut B.
Functional screening of Alzheimer risk loci identifies PTK2B as an in vivo modulator and early marker of Tau pathology.
Mol. Psychiatry (2017) 22(6) 874-883 [ PubMed ID = 27113998 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCCTGGAAAGTCTAAGTCCC 
 Primer Seq. 3'
aatctagaggtaccGTGGTGATGGTGACCTCTCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCCTGGAAA GTCTAAGTCC CCCACTCCGT TGCCCGGAAA ATCACAGGCC GCCCAGCATC 
0061 ACCAGTTCCG CGCTGCCGCA GCAGCAGCAG GGCCCGAAAA ACCGGAACAA GGCCTGGAGT 
0121 AAGAGGCAAC ACAAGGCCGG CGGGNAAGCA CAACCCCAGT GCCTGTGTCG GCGCAAGCAG 
0181 TGGCCAGGCC CAGTCTACGG GCTCCTCTGT CATAGCCGCG ACTCTCCTTC CCACTGCGGC 
0241 GTCGGCNTCA CAAGGCGGAT CTCGAGAACA TCCAGAATAT CCATAACAAA AATCTGACTG 
0301 CCGGCGGTGG AGTCAACCAT CATGGGAACG CCGGAACAGC GCATCACTGC GGTGGCGGTG 
0361 GTGCCGGCGC CCATCATGCC GCAGCGGGTG GCCACCATCA CCATCACAAC ACGAGGCTGG 
0421 CGCAAAACGC TGCCGCTGGT GGAGCCAGCG GAGGAGGAAC CATTCAAATG CATAAGAAAA 
0481 TGTTGAGAGG TCACCATCAC CAC 
 in silico PCR Fragment
0001 CGCCTGGAAA GTCTAAGTCC CCCACTCCGT TGCCCGGAAA ATCACAGGCC GCCCAGCATC 
0061 ACCAGTTCCG CGCT-CCGCA GCAGCAGCAG GGCCCGAAAA ACCGGAACAA GGCCTGGAGT 
0121 AAGAGGCAAC ACAAGGCCGG CGGG-AAGCA CAACCCCAGT GCCTGTGTCG GCGCAAGCAG 
0181 TGGCCAGGCC CAGTCTACGG GCTCCTCGGT CATAGCCGCG ACTCTCCTTC CCACTGCGGC 
0241 GTCGGC-TCA CAAGGCGGAT CTCGAGAACA TCCAGAATAT CCATAACAAA AATCTGACTG 
0301 CCGGCGGTGG AGTCAACCAT CATGGGAACG CCGGAACAGC GCATCACGGC GGTGGCGGTG 
0361 GTGCCGGCGC CCATCATGCC GCAGCGGGTG GCCACCATCA CCATCACAAC ACTAGGCTGG 
0421 CGCAAAACGC TGCCGCTGGT GGAGCCAGCG GAGGAGGAAC CATTCAAATG CATAAGAAAA 
0481 TGTTGAGAGG TCACCATCAC CAC 
 Assemble Data

8276R-3.IR_full       1   CGCCTGGAAAGTCTAAGTCCCCCACTCCGTTGCCCGGAAAATCACAGGCCGCCCAGCATC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8276R-3.in silico     1   CGCCTGGAAAGTCTAAGTCCCCCACTCCGTTGCCCGGAAAATCACAGGCCGCCCAGCATC 60


8276R-3.IR_full       61  ACCAGTTCCGCGCTGCCGCAGCAGCAGCAGGGCCCGAAAAACCGGAACAAGGCCTGGAGT 120
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
8276R-3.in silico     61  ACCAGTTCCGCGCT-CCGCAGCAGCAGCAGGGCCCGAAAAACCGGAACAAGGCCTGGAGT 120


8276R-3.IR_full       121 AAGAGGCAACACAAGGCCGGCGGGNAAGCACAACCCCAGTGCCTGTGTCGGCGCAAGCAG 180
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
8276R-3.in silico     121 AAGAGGCAACACAAGGCCGGCGGG-AAGCACAACCCCAGTGCCTGTGTCGGCGCAAGCAG 180


8276R-3.IR_full       181 TGGCCAGGCCCAGTCTACGGGCTCCTCTGTCATAGCCGCGACTCTCCTTCCCACTGCGGC 240
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
8276R-3.in silico     181 TGGCCAGGCCCAGTCTACGGGCTCCTCGGTCATAGCCGCGACTCTCCTTCCCACTGCGGC 240


8276R-3.IR_full       241 GTCGGCNTCACAAGGCGGATCTCGAGAACATCCAGAATATCCATAACAAAAATCTGACTG 300
                          |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
8276R-3.in silico     241 GTCGGC-TCACAAGGCGGATCTCGAGAACATCCAGAATATCCATAACAAAAATCTGACTG 300


8276R-3.IR_full       301 CCGGCGGTGGAGTCAACCATCATGGGAACGCCGGAACAGCGCATCACTGCGGTGGCGGTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
8276R-3.in silico     301 CCGGCGGTGGAGTCAACCATCATGGGAACGCCGGAACAGCGCATCACGGCGGTGGCGGTG 360


8276R-3.IR_full       361 GTGCCGGCGCCCATCATGCCGCAGCGGGTGGCCACCATCACCATCACAACACGAGGCTGG 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
8276R-3.in silico     361 GTGCCGGCGCCCATCATGCCGCAGCGGGTGGCCACCATCACCATCACAACACTAGGCTGG 420


8276R-3.IR_full       421 CGCAAAACGCTGCCGCTGGTGGAGCCAGCGGAGGAGGAACCATTCAAATGCATAAGAAAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8276R-3.in silico     421 CGCAAAACGCTGCCGCTGGTGGAGCCAGCGGAGGAGGAACCATTCAAATGCATAAGAAAA 480


8276R-3.IR_full       481 TGTTGAGAGGTCACCATCACCAC 503
                          |||||||||||||||||||||||
8276R-3.in silico     481 TGTTGAGAGGTCACCATCACCAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078902.2  CG8276-RB, transcript variant B (bin3), mRNA 
100   482  NM_165468.1  CG8276-RA, transcript variant A (bin3), mRNA 
0.2   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0.2   NM_140096.3  CG18177-RB, transcript variant B (CG18177), mRNA 
0.2   NM_206310.1  CG18177-RA, transcript variant A (CG18177), mRNA 
0.2   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   11  40  NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_167029.1  CG10706-RC, transcript variant C (SK), mRNA 
0   NM_167031.1  CG10706-RA, transcript variant A (SK), mRNA 
0   NM_167032.1  CG10706-RB, transcript variant B (SK), mRNA 
0   NM_079318.2  CG10488-RA, transcript variant A (eyg), mRNA 
0   NM_001014582.1  CG10488-RB, transcript variant B (eyg), mRNA 
0   NM_080339.2  CG10706-RE, transcript variant E (SK), mRNA 
0   NM_167030.1  CG10706-RD, transcript variant D (SK), mRNA 
0   10  45  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   10  45  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   10  45  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_132953.1  CG13001-RA (CG13001), mRNA 
0   14  NM_167313.1  CG2467-RB, transcript variant B (CG2467), mRNA 
0   14  NM_132540.1  CG2467-RA, transcript variant A (CG2467), mRNA 
0   NM_144026.1  CG11458-RA (CG11458), mRNA 
0   15  NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0   NM_132196.2  CG10777-RB (CG10777), mRNA 
0   NM_079967.4  CG6611-RA, transcript variant A (ect), mRNA 
0   NM_168400.1  CG6611-RB, transcript variant B (ect), mRNA 
0   NM_168401.1  CG6611-RC, transcript variant C (ect), mRNA 
0   15  47  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   15  47  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   35  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   16  NM_001014571.1  CG33556-RA (form3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.