National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8261R-2 
 Symbol Ggamma1  Full Name G protein gamma 1 
 CG No CG8261  Old CG No CG8261 
 Synonyms Gbetagamma, Ggamma, G[[gamma]], l(2)k08017, Ggamma1, Ggamma-1, D-G[[gamma]]1, dg1alpha, CG8261, bro4, Gg1 
 Accession No (Link to NCBI) NM_165631.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ishimoto H, Takahashi K, Ueda R, Tanimura T.
G-protein gamma subunit 1 is required for sugar reception in Drosophila.
EMBO J. (2005) 24(18) 3259-65 [ PubMed ID = 16121192 ] [ RRC reference ]

Yao CA, Carlson JR.
Role of G-proteins in odor-sensing and CO2-sensing neurons in Drosophila.
J. Neurosci. (2010) 30(13) 4562-72 [ PubMed ID = 20357107 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGACGTAATGTCATCATC 
 Primer Seq. 3'
aatctagaggtaccTTACTTGTTAACGTGGCTGG 
 Predicted Fragment Size
510 
 IR fragment full Seq
0001 ATGGACGTAA TGTCATCATC CCTGCAGCAG CAGCGCGTCG TGGTGGAGCA GCTGCGTCGC 
0061 GAGGCTGCCA TCGACCGCCA GACGATCTCG GAGTCATGCG CTAAGATGAT GAAGTACATC 
0121 ACGGAGCACG AGCAGGAGGA CTACCTGCTC ACCGGGTTCA CCAGCCAGAA GGTGAATCCC 
0181 TTCCGCGAGA AGTCGTCCTG CACCGTTCTC TAAGGAGGCG GTGAGGATGG TCCGCCGTTG 
0241 CCGAGGAGTC AGCGATCGCC GGCGGACGTT TAGCTTATTT TTAGTTTAGC AAGATGGATT 
0301 AGGACGCAAA CGTGTGTGGA GTACTACCCC AGTACCAGTA TCAACGCCAC CTGGAACAAT 
0361 ATATAGTTGT GCAGAAGCCA CAAAAGCTAC GATTGTCATA AGCAATATCA TTACAAGAAG 
0421 TTTGAATTCC AATTCTAATT CCAATTGCGA GGAATATATA TATATATTTG AATCGATATA 
0481 TCAATGTGTA CCAGCCACGT TAACAAGTAA  
 in silico PCR Fragment
0001 ATGGACGTAA TGTCATCATC CCTGCAGCAG CAGCGCGTCG TGGTGGAGCA GCTGCGTCGC 
0061 GAGGCTGCCA TCGACCGCCA GACGATCTCG GAGTCATGCG CTAAGATGAT GAAGTACATC 
0121 ACGGAGCACG AGCAGGAGGA CTACCTGCTC ACCGGGTTCA CCAGCCAGAA GGTGAATCCC 
0181 TTCCGCGAGA AGTCGTCCTG CACCGTTCTC TAAGGAGGCG GTGAGGATGG TCCGCCGTTG 
0241 CCGAGGAGTC AGCGATCGCC GGCGGACGTT TAGCTTATTT TTAGTTTAGC AAGATGGATT 
0301 AGGACGCAAA CGTGTGTGGA GTACTACCCC AGTACCAGTA TCAACGCCAC CTGGAACAAT 
0361 ATATAGTTGT GCAGAAGCCA CAAAAGCTAC GATTGTCATA AGCAATATCA TTACAAGAAG 
0421 TTTGAATTCC AATTCTAATT CCAATTGCGA GGAATATATA TATATATTTG AATCGATATA 
0481 TCAATGTGTA CCAGCCACGT TAACAAGTAA  
 Assemble Data

8261R-2.IR_full       1   ATGGACGTAATGTCATCATCCCTGCAGCAGCAGCGCGTCGTGGTGGAGCAGCTGCGTCGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     1   ATGGACGTAATGTCATCATCCCTGCAGCAGCAGCGCGTCGTGGTGGAGCAGCTGCGTCGC 60


8261R-2.IR_full       61  GAGGCTGCCATCGACCGCCAGACGATCTCGGAGTCATGCGCTAAGATGATGAAGTACATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     61  GAGGCTGCCATCGACCGCCAGACGATCTCGGAGTCATGCGCTAAGATGATGAAGTACATC 120


8261R-2.IR_full       121 ACGGAGCACGAGCAGGAGGACTACCTGCTCACCGGGTTCACCAGCCAGAAGGTGAATCCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     121 ACGGAGCACGAGCAGGAGGACTACCTGCTCACCGGGTTCACCAGCCAGAAGGTGAATCCC 180


8261R-2.IR_full       181 TTCCGCGAGAAGTCGTCCTGCACCGTTCTCTAAGGAGGCGGTGAGGATGGTCCGCCGTTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     181 TTCCGCGAGAAGTCGTCCTGCACCGTTCTCTAAGGAGGCGGTGAGGATGGTCCGCCGTTG 240


8261R-2.IR_full       241 CCGAGGAGTCAGCGATCGCCGGCGGACGTTTAGCTTATTTTTAGTTTAGCAAGATGGATT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     241 CCGAGGAGTCAGCGATCGCCGGCGGACGTTTAGCTTATTTTTAGTTTAGCAAGATGGATT 300


8261R-2.IR_full       301 AGGACGCAAACGTGTGTGGAGTACTACCCCAGTACCAGTATCAACGCCACCTGGAACAAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     301 AGGACGCAAACGTGTGTGGAGTACTACCCCAGTACCAGTATCAACGCCACCTGGAACAAT 360


8261R-2.IR_full       361 ATATAGTTGTGCAGAAGCCACAAAAGCTACGATTGTCATAAGCAATATCATTACAAGAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     361 ATATAGTTGTGCAGAAGCCACAAAAGCTACGATTGTCATAAGCAATATCATTACAAGAAG 420


8261R-2.IR_full       421 TTTGAATTCCAATTCTAATTCCAATTGCGAGGAATATATATATATATTTGAATCGATATA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8261R-2.in silico     421 TTTGAATTCCAATTCTAATTCCAATTGCGAGGAATATATATATATATTTGAATCGATATA 480


8261R-2.IR_full       481 TCAATGTGTACCAGCCACGTTAACAAGTAA 510
                          ||||||||||||||||||||||||||||||
8261R-2.in silico     481 TCAATGTGTACCAGCCACGTTAACAAGTAA 510

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   492  NM_165631.1  CG8261-RA, transcript variant A (Ggamma1), mRNA 
100   492  NM_165634.1  CG8261-RE, transcript variant E (Ggamma1), mRNA 
100   492  NM_165632.1  CG8261-RB, transcript variant B (Ggamma1), mRNA 
100   492  NM_165633.1  CG8261-RD, transcript variant D (Ggamma1), mRNA 
100   492  NM_078938.2  CG8261-RC, transcript variant C (Ggamma1), mRNA 
0.4   NM_080265.2  CG15367-RA (Dip1), mRNA 
0.4   13  NM_136844.3  CG9005-RA (CG9005), mRNA 
0.2   NM_001042819.1  CG5424-RF, transcript variant F (f), mRNA 
0   NM_165334.1  CG2488-RA, transcript variant A (phr6-4), mRNA 
0   NM_057840.3  CG2488-RB, transcript variant B (phr6-4), mRNA 
0   NM_139557.1  CG12014-RA (CG12014), mRNA 
0   21  NM_138767.2  CG14296-RB, transcript variant B (endoA), mRNA 
0   21  NM_169838.1  CG14296-RA, transcript variant A (endoA), mRNA 
0   NM_167549.1  CG4829-RA, transcript variant A (CG4829), mRNA 
0   NM_132942.2  CG4829-RC, transcript variant C (CG4829), mRNA 
0   NM_167550.1  CG4829-RB, transcript variant B (CG4829), mRNA 
0   12  NM_143297.1  CG3361-RA (mrt), mRNA 
0   22  NM_142527.2  CG5629-RB, transcript variant B (CG5629), mRNA 
0   NM_166337.1  CG11949-RB, transcript variant B (cora), mRNA 
0   NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_166338.1  CG11949-RD, transcript variant D (cora), mRNA 
0   NM_166336.1  CG11949-RC, transcript variant C (cora), mRNA 
0   10  NM_164966.2  CG6464-RA (salm), mRNA 
0   11  NM_133138.1  CG7884-RA (CG7884), mRNA 
0   10  NM_135936.2  CG4993-RB, transcript variant B (PRL-1), mRNA 
0   10  NM_165150.1  CG4993-RA, transcript variant A (PRL-1), mRNA 
0   NM_166257.1  CG5785-RB (thr), mRNA 
0   NM_137893.2  CG30190-RA (CG30190), mRNA 
0   NM_135602.2  CG6743-RA (Nup170), mRNA 
0   39  NM_078545.2  CG12653-RA (btd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.