National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8222R-2 
 Symbol Pvr  Full Name PDGF- and VEGF-receptor related 
 CG No CG8222  Old CG No CG8222 
 Synonyms VEGFR, PVR, pvr, CG8222, VEGFR-A, Vegfr-c, Vegfr-b, stai, Vegfr, DmVEGFR, vgr1, VGR1, CT24332, Vgr1, Pvr 
 Accession No (Link to NCBI) NM_078785.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Sansone CL, Cohen J, Yasunaga A, Xu J, Osborn G, Subramanian H, Gold B, Buchon N, Cherry S.
Microbiota-Dependent Priming of Antiviral Intestinal Immunity in Drosophila.
Cell Host Microbe (2015) 18(5) 571-81 [ PubMed ID = 26567510 ] [ RRC reference ]

Tsuzuki S, Matsumoto H, Furihata S, Ryuda M, Tanaka H, Sung EJ, Bird GS, Zhou Y, Shears SB, Hayakawa Y.
Switching between humoral and cellular immune responses in Drosophila is guided by the cytokine GBP.
Nat Commun (2014) 5 4628 [ PubMed ID = 25130174 ] [ RRC reference ]

Garlena RA, Lennox AL, Baker LR, Parsons TE, Weinberg SM, Stronach BE.
The receptor tyrosine kinase Pvr promotes tissue closure by coordinating corpse removal and epidermal zippering.
Development (2015) 142(19) 3403-15 [ PubMed ID = 26293306 ] [ RRC reference ]

Ishimaru S, Ueda R, Hinohara Y, Ohtani M, Hanafusa H.
PVR plays a critical role via JNK activation in thorax closure during Drosophila metamorphosis.
EMBO J. (2004) 23(20) 3984-94 [ PubMed ID = 15457211 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCTTCCGCGGTTGATTCTGCTGCCACTGCTCCTGATTTTGCGGATCTCGTGGAGCGATG 60

                          ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTGTGCCTTTGCAGCAGTTCTCACCGGATCCCGATGACAGCATCGAGAACTGCGGCGGCG 120

                          | ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| silico     121 AGAATGGAGCTCCCCTGATGACGCCCTGCAAGAGCGCCATTAT-CCTGGATGCCCAGACG 180

                          |||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGCA-CCACGCTTAAGTGCGAGGACGACGAGCCGATGAGCTGGTGGACCAGTCAATCGCA 240

                          |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATATGTGCATGTGAAGTCCTTCGATAATACGGAGGATCCGGCTCGACCATTCGGAACTAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCTGCATCTCATCGAAGTGACGGCTGACTATGTGGCAGCCTACTATTGCGTGAAGACTTC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAATTCAGTCAGATCGCCAAGGAGGAGCAGTCGGACGAGGCGATGATCGAATTGGTTAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCAAGGATACGCCAGCTCCATCTACGTGTACGTGAATGATCCGGACACTAAGCTGGTCGA 480

8222R-2.IR_full       481 TAGTCATAACGTGGTGACGGCA 502
                          |||||||||||||||||||||| silico     481 TAGTCATAACGTGGTGACGGCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_205927.1  CG8222-RD, transcript variant D (Pvr), mRNA 
100   482  NM_164801.1  CG8222-RB, transcript variant B (Pvr), mRNA 
100   482  NM_078785.2  CG8222-RA, transcript variant A (Pvr), mRNA 
100   482  NM_205925.1  CG8222-RF, transcript variant F (Pvr), mRNA 
100   482  NM_205926.1  CG8222-RE, transcript variant E (Pvr), mRNA 
86.92   419  NM_175983.1  CG8222-RC, transcript variant C (Pvr), mRNA 
0   NM_057631.4  CG5786-RA (ppan), mRNA 
0   NM_001043216.1  CG34113-RO, transcript variant O (CG34113), mRNA 
0   NM_001043217.1  CG34113-RP, transcript variant P (CG34113), mRNA 
0   NM_142463.2  CG7678-RA (CG7678), mRNA 
0   NM_140132.3  CG32056-RA, transcript variant A (CG32056), mRNA 
0   NM_168404.1  CG32056-RB, transcript variant B (CG32056), mRNA 
0   NM_168403.1  CG32056-RC, transcript variant C (CG32056), mRNA 
0   NM_132792.2  CG6227-RA (CG6227), mRNA 
0   NM_079833.2  CG7917-RA (Nlp), mRNA 
0   NM_141800.1  CG14701-RA (CG14701), mRNA 
0   NM_166096.1  CG30470-RA (CG30470), mRNA 
0   NM_169482.1  CG7340-RA, transcript variant A (granny-smith), mRNA 
0   NM_169483.1  CG7340-RC, transcript variant C (granny-smith), mRNA 
0   NM_141983.2  CG7340-RB, transcript variant B (granny-smith), mRNA 
0   12  NM_170367.1  CG1866-RA, transcript variant A (Moca-cyp), mRNA 
0   12  NM_143361.3  CG1866-RB, transcript variant B (Moca-cyp), mRNA 
0   NM_080157.2  CG11648-RB, transcript variant B (Abd-B), mRNA 
0   10  NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_168038.1  CG32264-RD, transcript variant D (CG32264), mRNA 
0   NM_132164.1  CG18155-RA, transcript variant A (CG18155), mRNA 
0   NM_166949.1  CG2694-RA, transcript variant A (CG2694), mRNA 
0   NM_130668.2  CG2694-RB, transcript variant B (CG2694), mRNA 
0   NM_206637.1  CG18155-RB, transcript variant B (CG18155), mRNA 
0   NM_135391.2  CG13095-RA (CG13095), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.