National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8203R-1 
 Symbol Cdk5  Full Name Cyclin-dependent kinase 5 
 CG No CG8203  Old CG No CG8203 
 Synonyms CDK5, CG8203, cdk5, DmCdk5, Cdk5 
 Accession No (Link to NCBI) NM_057732.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saito T, Oba T, Shimizu S, Asada A, Iijima KM, Ando K.
Cdk5 increases MARK4 activity and augments pathological tau accumulation and toxicity through tau phosphorylation at Ser262.
Hum Mol Genet (2019) 28(18) 3062-3071 [ PubMed ID = 31174206 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATGGAGAAGATCGGGGAGGG 
 Primer Seq. 3'
aatctagaggtaccAGGGTCACCACTTCTGCGGAG 
 Predicted Fragment Size
477 
 IR fragment full Seq
0001 AATGNAGAAG ATCGGGGAGG GCACCTACGG CACGGTGTTC AAGGGTCGCA ACCGCGACAC 
0061 CATGGAAATA GTGGCCCTGA AACGGGTGCG ACTGGACGAG GACGACGAGG GTGTGCCCAG 
0121 TTNCTGCCCT CCGGGAGATC TGCCTGCTGA AGGAGCTGAA GCACAAGAAC ATTGTGCGCC 
0181 NTCATAGACG TCCTGCACTC GGACAAGAAA CTCACCCTGG TCTTCGAGCA CTGCGACCAG 
0241 GACCTCAAGA AGTACTTTGA CAGCCTCAAC GGGGAGATCG ACATGGCCGT CTGCAGGAGC 
0301 TTTATGCTcC AACTGCTCCG CGGACTGGCC TTCTGCCACA GCCATAATGT CCTGCATCGC 
0361 GATCTGAAAC CACAGAACCT GCTGATCAAC AAAAACGGCG AGCTAAAGCT GGCTGACTTT 
0421 GGTCTGGCTA GAGcCTTTGG CATTCCCGTG AAGTGCTACT CCGCAGAAGT GGTGACCCT 
 in silico PCR Fragment
0001 AATGGAGAAG ATCGGGGAGG GCACCTACGG CACGGTGTTC AAGGGTCGCA ACCGCGACAC 
0061 CATGGAAATA GTGGCCCTGA AACGGGTGCG ACTGGACGAG GACGACGAGG GTGTGCCCAG 
0121 TT-CTGCCCT CCGGGAGATC TGCCTGCTGA AGGAGCTGAA GCACAAGAAC ATTGTGCGCC 
0181 -TCATAGACG TCCTGCACTC GGACAAGAAA CTCACCCTGG TCTTCGAGCA CTGCGACCAG 
0241 GACCTCAAGA AGTACTTTGA CAGCCTCAAC GGGGAGATCG ACATGGCCGT CTGCAGGAGC 
0301 TTTATGCTCC AACTGCTCCG CGGACTGGCA TTCTGCCACA GCCATAATGT CCTGCATCGC 
0361 GATCTGAAAC CACAGAACCT GCTGATCAAC AAAAACGGCG AGCTAAAGCT AGCTGACTTT 
0421 GGTCTCGCTA GAGCCTTTGG CATTCCCGTG AAGTGCTACT CCGCAGAAGT GGTGACCCT 
 Assemble Data

8203R-1.IR_full       1   AATGNAGAAGATCGGGGAGGGCACCTACGGCACGGTGTTCAAGGGTCGCAACCGCGACAC 60
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
8203R-1.in silico     1   AATGGAGAAGATCGGGGAGGGCACCTACGGCACGGTGTTCAAGGGTCGCAACCGCGACAC 60


8203R-1.IR_full       61  CATGGAAATAGTGGCCCTGAAACGGGTGCGACTGGACGAGGACGACGAGGGTGTGCCCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8203R-1.in silico     61  CATGGAAATAGTGGCCCTGAAACGGGTGCGACTGGACGAGGACGACGAGGGTGTGCCCAG 120


8203R-1.IR_full       121 TTNCTGCCCTCCGGGAGATCTGCCTGCTGAAGGAGCTGAAGCACAAGAACATTGTGCGCC 180
                          || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8203R-1.in silico     121 TT-CTGCCCTCCGGGAGATCTGCCTGCTGAAGGAGCTGAAGCACAAGAACATTGTGCGCC 180


8203R-1.IR_full        181 TCATAGACGTCCTGCACTCGGACAAGAAACTCACCCTGGTCTTCGAGCACTGCGACCAG 239
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8203R-1.in silico      181 TCATAGACGTCCTGCACTCGGACAAGAAACTCACCCTGGTCTTCGAGCACTGCGACCAG 239


8203R-1.IR_full       241 GACCTCAAGAAGTACTTTGACAGCCTCAACGGGGAGATCGACATGGCCGTCTGCAGGAGC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8203R-1.in silico     241 GACCTCAAGAAGTACTTTGACAGCCTCAACGGGGAGATCGACATGGCCGTCTGCAGGAGC 299


8203R-1.IR_full       301 TTTATGCTCCAACTGCTCCGCGGACTGGCCTTCTGCCACAGCCATAATGTCCTGCATCGC 359
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
8203R-1.in silico     301 TTTATGCTCCAACTGCTCCGCGGACTGGCATTCTGCCACAGCCATAATGTCCTGCATCGC 359


8203R-1.IR_full       361 GATCTGAAACCACAGAACCTGCTGATCAACAAAAACGGCGAGCTAAAGCTGGCTGACTTT 419
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
8203R-1.in silico     361 GATCTGAAACCACAGAACCTGCTGATCAACAAAAACGGCGAGCTAAAGCTAGCTGACTTT 419


8203R-1.IR_full       421 GGTCTGGCTAGAGCCTTTGGCATTCCCGTGAAGTGCTACTCCGCAGAAGTGGTGACCCT 478
                          ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
8203R-1.in silico     421 GGTCTCGCTAGAGCCTTTGGCATTCCCGTGAAGTGCTACTCCGCAGAAGTGGTGACCCT 478

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   459  NM_057732.3  CG8203-RA (Cdk5), mRNA 
0   NM_136002.1  CG15142-RA (CG15142), mRNA 
0   NM_001042817.1  CG4937-RB, transcript variant B (RhoGAP15B), mRNA 
0   NM_132955.1  CG4937-RA, transcript variant A (RhoGAP15B), mRNA 
0   NM_137098.2  CG8485-RA, transcript variant A (CG8485), mRNA 
0   NM_166043.1  CG8485-RD, transcript variant D (CG8485), mRNA 
0   NM_166041.1  CG8485-RB, transcript variant B (CG8485), mRNA 
0   NM_166042.1  CG8485-RC, transcript variant C (CG8485), mRNA 
0   NM_078666.2  CG8146-RA (Socs16D), mRNA 
0   NM_138020.2  CG3105-RA (CG3105), mRNA 
0   NM_168245.2  CG8110-RB, transcript variant B (syd), mRNA 
0   NM_079913.2  CG8110-RA, transcript variant A (syd), mRNA 
0   NM_168961.2  CG32451-RB, transcript variant B (SPoCk), mRNA 
0   NM_132908.2  CG4453-RA (Nup153), mRNA 
0   NM_169549.1  CG9351-RC, transcript variant C (flfl), mRNA 
0   NM_142047.1  CG9351-RA, transcript variant A (flfl), mRNA 
0   NM_169548.1  CG9351-RB, transcript variant B (flfl), mRNA 
0   NM_079771.1  CG11921-RA (fd96Ca), mRNA 
0   NM_079706.2  CG3412-RA (slmb), mRNA 
0   NM_176111.1  CG2049-RC, transcript variant C (Pkn), mRNA 
0   NM_176113.1  CG2049-RD, transcript variant D (Pkn), mRNA 
0   18  35  NM_079696.4  CG10498-RB, transcript variant B (cdc2c), mRNA 
0   18  35  NM_169916.1  CG10498-RA, transcript variant A (cdc2c), mRNA 
0   10  10  NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   10  10  NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_141068.2  CG7597-RA, transcript variant A (CG7597), mRNA 
0   NM_168912.1  CG7597-RB, transcript variant B (CG7597), mRNA 
0   10  NM_167525.1  CG9802-RB, transcript variant B (Cap), mRNA 
0   10  NM_078650.2  CG9802-RA, transcript variant A (Cap), mRNA 
0   NM_176459.1  CG17228-RD, transcript variant D (pros), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.