National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8182R-3 
 Symbol GalNAc-T1  Full Name GalNAc-T1 
 CG No CG8182  Old CG No CG8182 
 Synonyms pgant1, CG8182, GalNAc-T1 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCTGCCTCGGTTCCGTTCC 
 Primer Seq. 3'
aatctagaggtaccCTCAGCAGCACGGAGTAGGGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

8182R-3.IR full       1   ATGCTGCCTCGGTTCCGTTCCTTTTACGGCAAACTGATCATCTTCATCCTAGTCGCCCTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-3.in silico     1   ATGCTGCCTCGGTTCCGTTCCTTTTACGGCAAACTGATCATCTTCATCCTAGTCGCCCTC 60


8182R-3.IR full       61  TGCTTCATCCTCTACAGCAAGGTGCAGCAGAATGGTTCACCAGAGGAGCCACCTGTNGCG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
8182R-3.in silico     61  TGCTTCATCCTCTACAGCAAGGTGCAGCAGAATGGTTCACCAGAGGAGCCACCTGTAGCG 120


8182R-3.IR full       121 CCACTCGTCCGGGCGGCCGCTCTGCGAGGTCATGGGCGCGAGCGGTTCGAGGCGTATAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-3.in silico     121 CCACTCGTCCGGGCGGCCGCTCTGCGAGGTCATGGGCGCGAGCGGTTCGAGGCGTATAGC 180


8182R-3.IR full       181 GACAGTGAGAACGAGATAGCCCGACCCGCCACCCAGTCTCCGTATGAACAAATAATCCAA 240
                          |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
8182R-3.in silico     181 GACAGTGAGAACGAGATAGCCCGACCCGCCACCCAGTCGCCGTACGAACAAATAATCCAA 240


8182R-3.IR full       241 CTGGATCTTCAGAAACAGAAGGTGGGACTCGGCGAACAGGGCGTGGCAGTGCATCTTTCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-3.in silico     241 CTGGATCTTCAGAAACAGAAGGTGGGACTCGGCGAACAGGGCGTGGCAGTGCATCTTTCC 300


8182R-3.IR full       301 GGTGCCGCCAAGGAACGAGGCGATGAGATCTACAAGAAGATTGCCCTCAACGAGGAGCTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-3.in silico     301 GGTGCCGCCAAGGAACGAGGCGATGAGATCTACAAGAAGATTGCCCTCAACGAGGAGCTA 360


8182R-3.IR full       361 AGCGAGCAGTTGACCTACAACCGGAGTGTCGGTGACCACCGGAATCCCCTGTGCGCCAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-3.in silico     361 AGCGAGCAGTTGACCTACAACCGGAGTGTCGGTGACCACCGGAATCCCCTGTGCGCCAAA 420


8182R-3.IR full       421 CAGCGCTTTGATTCCGACTCCCTGCCCACCGCCAGTGTGGTCATCATCTTCTTCAACGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-3.in silico     421 CAGCGCTTTGATTCCGACTCCCTGCCCACCGCCAGTGTGGTCATCATCTTCTTCAACGAA 480


8182R-3.IR full       481 CCCTACTCCGTGCTGCTGAG 500
                          ||||||||||||||||||||
8182R-3.in silico     481 CCCTACTCCGTGCTGCTGAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137199.2  GalNAc-T1 CG8182-RA, transcript variant A (GalNAc-T1), mRNA 
100  482  NM_166099.1  GalNAc-T1 CG8182-RB, transcript variant B (GalNAc-T1), mRNA 
0.2  NM_133012.2  CG32560-RA (CG32560), mRNA 
NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
NM_140518.1  Argonaute 2 CG7439-RB, transcript variant B (AGO2), mRNA 
NM_168626.1  Argonaute 2 CG7439-RC, transcript variant C (AGO2), mRNA 
NM_140472.1  CG13466-RA (CG13466), mRNA 
NM_057242.3  Kinesin heavy chain CG7765-RA (Khc), mRNA 
NM_143343.2  CG4963-RA (CG4963), mRNA 
NM_134501.1  CG14227-RA (CG14227), mRNA 
NM_140067.1  CG3654-RD (CG3654), mRNA 
NM_079108.2  benign gonial cell neoplasm CG30170-RA (bgcn), mRNA 
NM_001038869.1  CG33958-RA (CG33958), mRNA 
NM_140333.2  CG4069-RA (CG4069), mRNA 
NM_142663.3  CG15695-RA (CG15695), mRNA 
NM_133011.2  CG8173-RA (CG8173), mRNA 
NM_079824.2  Dopamine receptor 2 CG18741-RB, transcript variant B (DopR2), mRNA 
NM_170420.1  Dopamine receptor 2 CG18741-RA, transcript variant A (DopR2), mRNA 
NM_079671.2  stripe CG7847-RA, transcript variant A (sr), mRNA 
NM_136739.1  CG11825-RA (CG11825), mRNA 
15  NM_139492.2  polypeptide GalNAc transferase 6 CG2103-RA, transcript variant A (pgant6), mRNA 
15  NM_167966.1  polypeptide GalNAc transferase 6 CG2103-RB, transcript variant B (pgant6), mRNA 
NM_164539.1  polypeptide GalNAc transferase 4 CG31956-RA (pgant4), mRNA 
NM_170281.1  CG5476-RA (CG5476), mRNA 
NM_170279.2  CG6447-RA, transcript variant A (CG6447), mRNA 
NM_170280.1  CG6447-RB, transcript variant B (CG6447), mRNA 
NM_144077.2  CG18675-RA (CG18675), mRNA 
NM_132239.1  CG1632-RA (CG1632), mRNA 
NM_057401.3  aurora CG3068-RA (aur), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.