National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8182R-1 
 Symbol GalNAc-T1  Full Name GalNAc-T1 
 CG No CG8182  Old CG No CG8182 
 Synonyms pgant1, CG8182, GalNAc-T1 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCTGCCTCGGTTCCGTTCC 
 Primer Seq. 3'
aatctagaggtaccCTCAGCAGCACGGAGTAGGGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCTGCCTC GGTTCCGTTC CTTTTACGGC AAACTGATCA TCTTCATCCT AGTCGCCCTC 
0061 TGCTTCATCC TCTACAGCAA GGTGCAGCAG AATGGTTCAC CAGAGGAGCC ACCTGTNGCG 
0121 CCACTCGTCC GGGCGGCCGC TCTGCGAGGT CATGGGCGCG AGCGGTTCGA GGCGTATAGC 
0181 GACAGTGAGA ACGAGATAGC CCGACCCGCC ACCCAGTCTC CGTATGAACA AATAATCCAA 
0241 CTGGATCTTC AGAAACAGAA GGTGGGACTC GGCGAACAGG GCGTGGCAGT GCATCTTTCC 
0301 GGTGCCGCCA AGGAACGAGG CGATGAGATC TACAAGAAGA TTGCCCTCAA CGAGGAGCTA 
0361 AGCGAGCAGT TGACCTACAA CCGGAGTGTC GGTGACCACC GGAATCCCCT GTGCGCCAAA 
0421 CAGCGCTTTG ATTCCGACTC CCTGCCCACC GCCAGTGTGG TCATCATCTT CTTCAACGAA 
0481 CCCTACTCCG TGCTGCTGAG  
 in silico PCR Fragment
0001 atgctgcctc ggttccgttc cttttacggc aaactgatca tcttcatcct agtcgccctc 
0061 tgcttcatcc tctacagcaa ggtgcagcag aatggttcac cagaggagcc acctgtagcg 
0121 ccactcgtcc gggcggccgc tctgcgaggt catgggcgcg agcggttcga ggcgtatagc 
0181 gacagtgaga acgagatagc ccgacccgcc acccagtcgc cgtacgaaca aataatccaa 
0241 ctggatcttc agaaacagaa ggtgggactc ggcgaacagg gcgtggcagt gcatctttcc 
0301 ggtgccgcca aggaacgagg cgatgagatc tacaagaaga ttgccctcaa cgaggagcta 
0361 agcgagcagt tgacctacaa ccggagtgtc ggtgaccacc ggaatcccct gtgcgccaaa 
0421 cagcgctttg attccgactc cctgcccacc gccagtgtgg tcatcatctt cttcaacgaa 
0481 ccctactccg tgctgctgag  
 Assemble Data

8182R-1.IR full       1   ATGCTGCCTCGGTTCCGTTCCTTTTACGGCAAACTGATCATCTTCATCCTAGTCGCCCTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-1.in silico     1   ATGCTGCCTCGGTTCCGTTCCTTTTACGGCAAACTGATCATCTTCATCCTAGTCGCCCTC 60


8182R-1.IR full       61  TGCTTCATCCTCTACAGCAAGGTGCAGCAGAATGGTTCACCAGAGGAGCCACCTGTNGCG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
8182R-1.in silico     61  TGCTTCATCCTCTACAGCAAGGTGCAGCAGAATGGTTCACCAGAGGAGCCACCTGTAGCG 120


8182R-1.IR full       121 CCACTCGTCCGGGCGGCCGCTCTGCGAGGTCATGGGCGCGAGCGGTTCGAGGCGTATAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-1.in silico     121 CCACTCGTCCGGGCGGCCGCTCTGCGAGGTCATGGGCGCGAGCGGTTCGAGGCGTATAGC 180


8182R-1.IR full       181 GACAGTGAGAACGAGATAGCCCGACCCGCCACCCAGTCTCCGTATGAACAAATAATCCAA 240
                          |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||
8182R-1.in silico     181 GACAGTGAGAACGAGATAGCCCGACCCGCCACCCAGTCGCCGTACGAACAAATAATCCAA 240


8182R-1.IR full       241 CTGGATCTTCAGAAACAGAAGGTGGGACTCGGCGAACAGGGCGTGGCAGTGCATCTTTCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-1.in silico     241 CTGGATCTTCAGAAACAGAAGGTGGGACTCGGCGAACAGGGCGTGGCAGTGCATCTTTCC 300


8182R-1.IR full       301 GGTGCCGCCAAGGAACGAGGCGATGAGATCTACAAGAAGATTGCCCTCAACGAGGAGCTA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-1.in silico     301 GGTGCCGCCAAGGAACGAGGCGATGAGATCTACAAGAAGATTGCCCTCAACGAGGAGCTA 360


8182R-1.IR full       361 AGCGAGCAGTTGACCTACAACCGGAGTGTCGGTGACCACCGGAATCCCCTGTGCGCCAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-1.in silico     361 AGCGAGCAGTTGACCTACAACCGGAGTGTCGGTGACCACCGGAATCCCCTGTGCGCCAAA 420


8182R-1.IR full       421 CAGCGCTTTGATTCCGACTCCCTGCCCACCGCCAGTGTGGTCATCATCTTCTTCAACGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8182R-1.in silico     421 CAGCGCTTTGATTCCGACTCCCTGCCCACCGCCAGTGTGGTCATCATCTTCTTCAACGAA 480


8182R-1.IR full       481 CCCTACTCCGTGCTGCTGAG 500
                          ||||||||||||||||||||
8182R-1.in silico     481 CCCTACTCCGTGCTGCTGAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_137199.2  GalNAc-T1 CG8182-RA, transcript variant A (GalNAc-T1), mRNA 
100  482  NM_166099.1  GalNAc-T1 CG8182-RB, transcript variant B (GalNAc-T1), mRNA 
0.2  NM_133012.2  CG32560-RA (CG32560), mRNA 
NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
NM_140518.1  Argonaute 2 CG7439-RB, transcript variant B (AGO2), mRNA 
NM_168626.1  Argonaute 2 CG7439-RC, transcript variant C (AGO2), mRNA 
NM_140472.1  CG13466-RA (CG13466), mRNA 
NM_057242.3  Kinesin heavy chain CG7765-RA (Khc), mRNA 
NM_143343.2  CG4963-RA (CG4963), mRNA 
NM_134501.1  CG14227-RA (CG14227), mRNA 
NM_140067.1  CG3654-RD (CG3654), mRNA 
NM_079108.2  benign gonial cell neoplasm CG30170-RA (bgcn), mRNA 
NM_001038869.1  CG33958-RA (CG33958), mRNA 
NM_140333.2  CG4069-RA (CG4069), mRNA 
NM_142663.3  CG15695-RA (CG15695), mRNA 
NM_133011.2  CG8173-RA (CG8173), mRNA 
NM_079824.2  Dopamine receptor 2 CG18741-RB, transcript variant B (DopR2), mRNA 
NM_170420.1  Dopamine receptor 2 CG18741-RA, transcript variant A (DopR2), mRNA 
NM_079671.2  stripe CG7847-RA, transcript variant A (sr), mRNA 
NM_136739.1  CG11825-RA (CG11825), mRNA 
15  NM_139492.2  polypeptide GalNAc transferase 6 CG2103-RA, transcript variant A (pgant6), mRNA 
15  NM_167966.1  polypeptide GalNAc transferase 6 CG2103-RB, transcript variant B (pgant6), mRNA 
NM_164539.1  polypeptide GalNAc transferase 4 CG31956-RA (pgant4), mRNA 
NM_170281.1  CG5476-RA (CG5476), mRNA 
NM_170279.2  CG6447-RA, transcript variant A (CG6447), mRNA 
NM_170280.1  CG6447-RB, transcript variant B (CG6447), mRNA 
NM_144077.2  CG18675-RA (CG18675), mRNA 
NM_132239.1  CG1632-RA (CG1632), mRNA 
NM_057401.3  aurora CG3068-RA (aur), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.