National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8171R-2 
 Symbol dup  Full Name double parked 
 CG No CG8171  Old CG No CG8171 
 Synonyms DUP/CDT1, CDT1, Cdt1, Dup, CDT1/DUP, fs(2)PA77, DUP, cdt1/dup, CG8171, l(2)k03308, l(2)51Ec, 19k, fs(2)ltoPA77, fs(2)51Fa, anon-WO0257455.31, dup 
 Accession No (Link to NCBI) NM_080139.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Park SY, Asano M.
The origin recognition complex is dispensable for endoreplication in Drosophila.
Proc. Natl. Acad. Sci. U.S.A. (2008) 105(34) 12343-8 [ PubMed ID = 18711130 ] [ RRC reference ]

Kohzaki H.
The function of replication and SCF complex during Drosophila wing development.
Front Biosci (Landmark Ed) (2018) 23 2235-2244 [ PubMed ID = 29772558 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCACTGCCCGACTAATTGTCA 
 Primer Seq. 3'
aatctagaggtaccGAGCTGCACGCTCATCTTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCACTGCCCG ACTAATTGTC ACCNCCNCTC AAGAGAGCAA AAAGAAGACA CCGGCTGCCG 
0061 CCAAGATGGA GCCACACATC AAGCAGCCCA AGCTGGTGCA ATTCATTAAA AAGGGCACTC 
0121 TGTCGCCCAG GAAACAGGCT CAGTCCAGGT AAGCTGGACG AGGAGGAGCT GCAGCAGTCG 
0181 TCGGCCATAA GCGAGCACAC GCCCAAGGTT AACTTCACCA TCACAAGCCA GCAGAATGCG 
0241 GACAATGTGC AGCGTGGCCC TGCGCACACC CACCAAGCAG ATCCTCAAGG ATGCCTCGCC 
0301 GATCAAGGCG GATCTCCGCC GTNCAGCTCA CTTTCGACGA GGTAAAAACG AAGGTATCGC 
0361 GGAGTGCCAA GCTGCAGGAA CTCAAGGCAG TGCTGGCCCT TAAGGCGGCG CTCGAGCAGA 
0421 AGCGCAAGGA GCAGGAGGAG CGCAACAGGA AACTCCgCGA CGCTGGCCCC TCCCCATCGA 
0481 AGTCCAAGAT GAGCGTGCAG CTC 
 in silico PCR Fragment
0001 GCACTGCCCG ACTAATTGTC ACCGCCGCTC AAGAGAGCAA AAAGAAGACA CCGGCTGCCG 
0061 CCAAGATGGA GCCACACATC AAGCAGCCCA AGCTGGTGCA ATTCATTAAA AAGGGCACTC 
0121 TGTCGCCCAG GAAACAGGCT CAGTCCA-GT AAGCTGGACG AGGAGGAGCT GCAGCAGTCG 
0181 TCGGCCATAA GCGAGCACAC GCCCAAGGTT AACTTCACCA TCACAAGCCA GCAGAATGCG 
0241 GACAATGTGC AGCGTGG-CC TGCGCACACC CACCAAGCAG ATCCTCAAGG ATGCCTCGCC 
0301 GATCAAGGCG GATCTCCGCC GT-CAGCTCA CTTTCGACGA GGTAAAAACG AAGGTATCGC 
0361 GGAGTGCCAA GCTGCAGGAA CTCAAGGCAG TGCTGGCCCT TAAGGCGGCG CTCGAGCAGA 
0421 AGCGCAAGGA GCAGGAGGAG CGCAACAGGA AACTCCGCGA CGCTGGCCCC TCCCCATCGA 
0481 AGTCCAAGAT GAGCGTGCAG CTC 
 Assemble Data

8171R-2.IR_full       1   GCACTGCCCGACTAATTGTCACCNCCNCTCAAGAGAGCAAAAAGAAGACACCGGCTGCCG 60
                          ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
8171R-2.in silico     1   GCACTGCCCGACTAATTGTCACCGCCGCTCAAGAGAGCAAAAAGAAGACACCGGCTGCCG 60


8171R-2.IR_full       61  CCAAGATGGAGCCACACATCAAGCAGCCCAAGCTGGTGCAATTCATTAAAAAGGGCACTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8171R-2.in silico     61  CCAAGATGGAGCCACACATCAAGCAGCCCAAGCTGGTGCAATTCATTAAAAAGGGCACTC 120


8171R-2.IR_full       121 TGTCGCCCAGGAAACAGGCTCAGTCCAGGTAAGCTGGACGAGGAGGAGCTGCAGCAGTCG 180
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
8171R-2.in silico     121 TGTCGCCCAGGAAACAGGCTCAGTCCA-GTAAGCTGGACGAGGAGGAGCTGCAGCAGTCG 180


8171R-2.IR_full       181 TCGGCCATAAGCGAGCACACGCCCAAGGTTAACTTCACCATCACAAGCCAGCAGAATGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8171R-2.in silico     181 TCGGCCATAAGCGAGCACACGCCCAAGGTTAACTTCACCATCACAAGCCAGCAGAATGCG 240


8171R-2.IR_full       241 GACAATGTGCAGCGTGGCCCTGCGCACACCCACCAAGCAGATCCTCAAGGATGCCTCGCC 300
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
8171R-2.in silico     241 GACAATGTGCAGCGTGG-CCTGCGCACACCCACCAAGCAGATCCTCAAGGATGCCTCGCC 300


8171R-2.IR_full       301 GATCAAGGCGGATCTCCGCCGTNCAGCTCACTTTCGACGAGGTAAAAACGAAGGTATCGC 360
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
8171R-2.in silico     301 GATCAAGGCGGATCTCCGCCGT-CAGCTCACTTTCGACGAGGTAAAAACGAAGGTATCGC 360


8171R-2.IR_full       361 GGAGTGCCAAGCTGCAGGAACTCAAGGCAGTGCTGGCCCTTAAGGCGGCGCTCGAGCAGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8171R-2.in silico     361 GGAGTGCCAAGCTGCAGGAACTCAAGGCAGTGCTGGCCCTTAAGGCGGCGCTCGAGCAGA 420


8171R-2.IR_full       421 AGCGCAAGGAGCAGGAGGAGCGCAACAGGAAACTCCGCGACGCTGGCCCCTCCCCATCGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8171R-2.in silico     421 AGCGCAAGGAGCAGGAGGAGCGCAACAGGAAACTCCGCGACGCTGGCCCCTCCCCATCGA 480


8171R-2.IR_full       481 AGTCCAAGATGAGCGTGCAGCTC 503
                          |||||||||||||||||||||||
8171R-2.in silico     481 AGTCCAAGATGAGCGTGCAGCTC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080139.3  CG8171-RA (dup), mRNA 
0.62   NM_165243.1  CG15154-RA, transcript variant A (Socs36E), mRNA 
0.62   NM_078869.4  CG15154-RB, transcript variant B (Socs36E), mRNA 
0.2   NM_057243.3  CG3228-RA (kz), mRNA 
0   13  55  87  NM_206342.1  CG33265-RA (CG33265), mRNA 
0   NM_058031.4  CG5277-RA (Ip259), mRNA 
0   12  NM_134505.1  CG14230-RA (CG14230), mRNA 
0   NM_135483.2  CG31712-RA (CG31712), mRNA 
0   NM_169601.1  CG7425-RA (eff), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_165053.1  CG31813-RA (CG31813), mRNA 
0   NM_144348.2  CG12135-RA (c12.1), mRNA 
0   16  NM_130478.2  CG2995-RA (CG2995), mRNA 
0   16  NM_169769.1  CG18212-RD, transcript variant D (CG18212), mRNA 
0   16  NM_169768.1  CG18212-RA, transcript variant A (CG18212), mRNA 
0   16  NM_142388.2  CG18212-RG, transcript variant G (CG18212), mRNA 
0   16  NM_206505.1  CG18212-RB, transcript variant B (CG18212), mRNA 
0   16  NM_169771.1  CG18212-RF, transcript variant F (CG18212), mRNA 
0   16  NM_169770.2  CG18212-RE, transcript variant E (CG18212), mRNA 
0   NM_165146.1  CG4894-RC, transcript variant C (Ca-alpha1D), mRNA 
0   NM_134429.2  CG4894-RA, transcript variant A (Ca-alpha1D), mRNA 
0   NM_165147.1  CG4894-RD, transcript variant D (Ca-alpha1D), mRNA 
0   NM_080365.2  CG4894-RB, transcript variant B (Ca-alpha1D), mRNA 
0   14  NM_142697.2  CG5862-RA (CG5862), mRNA 
0   NM_057262.2  CG1828-RA, transcript variant A (dre4), mRNA 
0   NM_167922.1  CG1828-RB, transcript variant B (dre4), mRNA 
0   NM_166059.1  CG30076-RA (CG30076), mRNA 
0   NM_001043173.1  CG40044-RA (CG40044), mRNA 
0   NM_001043174.1  CG40053-RA (CG40053), mRNA 
0   NM_080333.2  CG3346-RA (pon), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
Caspase-3 signal
N
+  
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.