National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8151R-2 
 Symbol Tfb1  Full Name Tfb1 
 CG No CG8151  Old CG No CG8151 
 Synonyms TFB1, CG8151, l(2)06949, Dmp62, l(2)06950, Tfb1 
 Accession No (Link to NCBI) NM_166048.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTACAAGAAGGGCGACGGCAC 
 Primer Seq. 3'
aatctagaggtaccAGCCGTCTGTCTGCGGCTTTA 
 Predicted Fragment Size
494 
 IR fragment full Seq
0001 GTACAAGAAG GGCGACGGCA CGCTCTACGT AATGAATGAG CGTGTGGCCT GGATGGCGGA 
0061 ACACCGGGAC ACGGNAACAG TCTCCCATCG TTATGCGGAT ATCAAGACTC AAAAGATATC 
0121 TCCTGAGGGC AAGCCCAAGG TGCAGCTGCA AGTGGTTCTT CACGACGGCA ACACATCGAC 
0181 CTTCCACTTC GTCAACCGCC AGGGACAGGC CGCAATGCTT GCCGACAGGG ATCAAGGTCA 
0241 AGGAGCTATT GCAGCAACTG CTTCCCAACT TCAAGCGGAA GGTGGACAAA GACCTGGAAG 
0301 ACAAGAACCG CATCCTTGTT GAGAATCCCA ACCTGCTGCA ACTCTACAAG GACCTTGTCA 
0361 TAACCAAAGT CCTAACCAGC GATGAGTTCT ggGCTGACGC ATGCCAAGGA TCACGCCCTT 
0421 AAGAAAATGG GCAGATCCCA GGAGATCGGT GTTTCTGGCG CCTTTCTGGC TGACATAAAG 
0481 CCGCAGACAG ACGGCT 
 in silico PCR Fragment
0001 GTACAAGAAG GGCGACGGCA CGCTCTACGT AATGAATGAG CGTGTGGCCT GGATGGCGGA 
0061 ACACCGGGAC ACGGTAACAG TCTCCCATCG TTATGCGGAT ATCAAGACTC AAAAGATATC 
0121 TCCTGAGGGC AAGCCCAAGG TGCAGCTGCA AGTGGTTCTT CACGACGGCA ACACATCGAC 
0181 CTTCCACTTC GTCAACCGCC AGGGACAGGC CGCAATGCTT GCCGACAGGG A-CAAGGTCA 
0241 AGGAGCTATT GCAGCAACTG CTTCCCAACT TCAAGCGGAA GGTGGACAAA GACCTGGAAG 
0301 ACAAGAACCG CATCCTTGTT GAGAATCCCA ACCTGCTGCA ACTCTACAAG GACCTTGTCA 
0361 TAACCAAAGT CCTAACCAGC GATGAGTTCT GGGCT-ACGC ATGCCAAGGA TCACGCCCTT 
0421 AAGAAAATGG GCAGATCCCA GGAGATCGGT GTTTCTGGCG CCTTTCTGGC TGACATAAAG 
0481 CCGCAGACAG ACGGCT 
 Assemble Data

8151R-2.IR_full       1   GTACAAGAAGGGCGACGGCACGCTCTACGTAATGAATGAGCGTGTGGCCTGGATGGCGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8151R-2.in silico     1   GTACAAGAAGGGCGACGGCACGCTCTACGTAATGAATGAGCGTGTGGCCTGGATGGCGGA 60


8151R-2.IR_full       61  ACACCGGGACACGGNAACAGTCTCCCATCGTTATGCGGATATCAAGACTCAAAAGATATC 120
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
8151R-2.in silico     61  ACACCGGGACACGGTAACAGTCTCCCATCGTTATGCGGATATCAAGACTCAAAAGATATC 120


8151R-2.IR_full       121 TCCTGAGGGCAAGCCCAAGGTGCAGCTGCAAGTGGTTCTTCACGACGGCAACACATCGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8151R-2.in silico     121 TCCTGAGGGCAAGCCCAAGGTGCAGCTGCAAGTGGTTCTTCACGACGGCAACACATCGAC 180


8151R-2.IR_full       181 CTTCCACTTCGTCAACCGCCAGGGACAGGCCGCAATGCTTGCCGACAGGGATCAAGGTCA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
8151R-2.in silico     181 CTTCCACTTCGTCAACCGCCAGGGACAGGCCGCAATGCTTGCCGACAGGGA-CAAGGTCA 240


8151R-2.IR_full       241 AGGAGCTATTGCAGCAACTGCTTCCCAACTTCAAGCGGAAGGTGGACAAAGACCTGGAAG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8151R-2.in silico     241 AGGAGCTATTGCAGCAACTGCTTCCCAACTTCAAGCGGAAGGTGGACAAAGACCTGGAAG 300


8151R-2.IR_full       301 ACAAGAACCGCATCCTTGTTGAGAATCCCAACCTGCTGCAACTCTACAAGGACCTTGTCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8151R-2.in silico     301 ACAAGAACCGCATCCTTGTTGAGAATCCCAACCTGCTGCAACTCTACAAGGACCTTGTCA 360


8151R-2.IR_full       361 TAACCAAAGTCCTAACCAGCGATGAGTTCTGGGCTGACGCATGCCAAGGATCACGCCCTT 420
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
8151R-2.in silico     361 TAACCAAAGTCCTAACCAGCGATGAGTTCTGGGCT-ACGCATGCCAAGGATCACGCCCTT 420


8151R-2.IR_full       421 AAGAAAATGGGCAGATCCCAGGAGATCGGTGTTTCTGGCGCCTTTCTGGCTGACATAAAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
8151R-2.in silico     421 AAGAAAATGGGCAGATCCCAGGAGATCGGTGTTTCTGGCGCCTTTCTGGCTGACATAAAG 480


8151R-2.IR_full       481 CCGCAGACAGACGGCT 496
                          ||||||||||||||||
8151R-2.in silico     481 CCGCAGACAGACGGCT 496

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   476  NM_137113.2  CG8151-RB, transcript variant B (Tfb1), mRNA 
100   476  NM_166048.1  CG8151-RA, transcript variant A (Tfb1), mRNA 
100   476  NM_166049.1  CG8151-RC, transcript variant C (Tfb1), mRNA 
0   NM_168980.1  CG11100-RC, transcript variant C (Mes2), mRNA 
0   NM_168979.2  CG11100-RB, transcript variant B (Mes2), mRNA 
0   NM_130488.2  CG3156-RA (CG3156), mRNA 
0   NM_136000.2  CG6453-RA (CG6453), mRNA 
0   NM_140020.2  CG5068-RA (CG5068), mRNA 
0   NM_001014545.1  CG33519-RB (Unc-89), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_001043036.1  CG17800-PAA (Dscam), mRNA 
0   NM_206138.1  CG15920-RB, transcript variant B (resilin), mRNA 
0   NM_137313.2  CG15920-RA, transcript variant A (resilin), mRNA 
0   NM_142805.3  CG6921-RB, transcript variant B (CG6921), mRNA 
0   NM_170022.1  CG6921-RA, transcript variant A (CG6921), mRNA 
0   NM_170023.1  CG6921-RC, transcript variant C (CG6921), mRNA 
0   NM_176302.1  CG6282-RB, transcript variant B (CG6282), mRNA 
0   NM_139986.2  CG6282-RA, transcript variant A (CG6282), mRNA 
0   NM_135222.2  CG11188-RA (CG11188), mRNA 
0   NM_164716.1  CG31632-RA (CG31632), mRNA 
0   NM_168387.1  CG6711-RA (Taf2), mRNA 
0   NM_166671.1  CG30164-RA (CG30164), mRNA 
0   NM_080257.2  CG6815-RA (bor), mRNA 
0   NM_001032265.1  CG4844-RA, transcript variant A (CG4844), mRNA 
0   NM_001032264.1  CG4844-RB, transcript variant B (CG4844), mRNA 
0   NM_001032266.1  CG18431-RA, transcript variant A (CG18431), mRNA 
0   NM_167449.1  CG6340-RD, transcript variant D (CG6340), mRNA 
0   NM_132806.2  CG6340-RB, transcript variant B (CG6340), mRNA 
0   NM_132926.1  CG13008-RA, transcript variant A (CG13008), mRNA 
0   NM_167537.1  CG13008-RB, transcript variant B (CG13008), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.