National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 8095R-2 
 Symbol scb  Full Name scab 
 CG No CG8095  Old CG No CG8095 
 Synonyms alphaPS3, E(sev-cycE)[e93], PS3, vol, alpha[[PS3]], alpha-PS3, Vol, CG8095, CT36929, CT21280, Dm0620, aPS3, E(Sev-CycE)E93, l(2)01288, alphaInt3, scb 
 Accession No (Link to NCBI) NM_079026.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Xie X, Auld VJ.
Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve.
Development (2011) 138(17) 3813-22 [ PubMed ID = 21828098 ] [ RRC reference ]

Nonaka S, Nagaosa K, Mori T, Shiratsuchi A, Nakanishi Y.
Integrin αPS3/βν-mediated phagocytosis of apoptotic cells and bacteria in Drosophila.
J Biol Chem (2013) 288(15) 10374-80 [ PubMed ID = 23426364 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   AATCGACAATGTTCCCTCACATATTCCTCGCCCTCTTGGCTCTGATCTCTCACATCGAA 59

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCATTCAATTTTATGCCGCGACCCAGTCGGGTGATAAACTCCCCGAAGCATCTGAAGTTC 119

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CACATAAACCAGACTCGCAGCTCCTACTTTGGATACACGCTTGTCATCCGCCAGACCAGC 179

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCATTGTGGGAGCCCCTAGAGCTCAATCCACCTTGGAATCGCAACGCACCATCAACGAA 239

                          ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| silico     241 ACGGGAGCGATCTACAGATGCTCCCTGACAAACGGTGTGTGCAGTCCATATGTCCTGGAT 299

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCCCGGGGCAATGTGGATGCGCCCTATAGTGAGTACACATTTGATTCGGAACGCAAGGAC 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTCAATGGCTGGGCGGATCGATGGACGGCGGCACCAAGGACACGGACAAGCTCCTCGTG 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTGCTCCTCGGTTCTACGCTCCCAGTTCCCGGGACAACCACCTGCATGGAGTCTGCTAC 479

8095R-2.IR_full       481 TGGGTGAATAATACGGTGGC 499
                          |||||||||||||||||||| silico     481 TGGGTGAATAATACGGTGGC 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079026.2  CG8095-RB, transcript variant B (scb), mRNA 
63.07   304  NM_166083.1  CG8095-RA, transcript variant A (scb), mRNA 
0   30  40  51  NM_137964.1  CG5372-RA (alphaPS5), mRNA 
0   NM_079919.2  CG5700-RB (prc), mRNA 
0   NM_057657.4  CG17158-RA (cpb), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   NM_141673.4  CG31352-RA (CG31352), mRNA 
0   12  NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_167088.1  CG3203-RB, transcript variant B (RpL17), mRNA 
0   NM_167089.1  CG3203-RC, transcript variant C (RpL17), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_167087.1  CG3203-RA, transcript variant A (RpL17), mRNA 
0   11  NM_001043277.1  CG31163-RD, transcript variant D (CG31163), mRNA 
0   11  NM_169997.3  CG31163-RB, transcript variant B (CG31163), mRNA 
0   NM_167193.1  CG32702-RA (CG32702), mRNA 
0   NM_142055.1  CG9322-RA (CG9322), mRNA 
0   NM_206274.2  CG12605-RC, transcript variant C (CG12605), mRNA 
0   NM_206275.2  CG12605-RA, transcript variant A (CG12605), mRNA 
0   NM_139588.3  CG12605-RB, transcript variant B (CG12605), mRNA 
0   NM_078571.2  CG1705-RA (Rst(1)JH), mRNA 
0   NM_134614.1  CG14621-RA (CG14621), mRNA 
0   NM_169374.1  CG31299-RA, transcript variant A (nocturnin), mRNA 
0   NM_165305.2  CG10188-RA, transcript variant A (CG10188), mRNA 
0   NM_136133.2  CG10188-RB, transcript variant B (CG10188), mRNA 
0   NM_169375.1  CG31299-RB, transcript variant B (nocturnin), mRNA 
0   NM_167023.1  CG32770-RA (CG32770), mRNA 
0   NM_176247.1  CG33143-RB, transcript variant B (CG33143), mRNA 
0   NM_176246.1  CG33143-RC, transcript variant C (CG33143), mRNA 
0   NM_080333.2  CG3346-RA (pon), mRNA 
0   NM_138093.2  CG4681-RA (CG4681), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.